ID: 1140601764

View in Genome Browser
Species Human (GRCh38)
Location 16:76485055-76485077
Sequence CAAAATAATTAGTTAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140601763_1140601764 -10 Left 1140601763 16:76485042-76485064 CCAAACATAGTTTCAAAATAATT 0: 1
1: 0
2: 1
3: 63
4: 686
Right 1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG 0: 1
1: 0
2: 0
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140601764 Original CRISPR CAAAATAATTAGTTAGAGTA AGG Intronic
908211343 1:61903513-61903535 CAAAAAAATTAGTAAGAATATGG - Intronic
909312693 1:74173365-74173387 TAAAATAATTATTAATAGTAAGG + Intronic
910151941 1:84158894-84158916 CAAGATAATTAAATAGAGAAAGG - Intronic
910299054 1:85684801-85684823 CAAAAGAATAATTTAGATTATGG - Intronic
911769178 1:101717499-101717521 CAAAATAATTAGAATAAGTAGGG - Intergenic
911826717 1:102496059-102496081 CATATTAATTACTTATAGTATGG + Intergenic
912114225 1:106384378-106384400 GATAATAATTAGTTATAGTGAGG - Intergenic
912227875 1:107756218-107756240 AAAAATAGCTAGTTACAGTATGG - Intronic
915867209 1:159515556-159515578 CAAACCAAAGAGTTAGAGTAAGG - Intergenic
917309874 1:173667956-173667978 CAAAAGAATTAGTTAGAAAGTGG - Intronic
917702233 1:177593105-177593127 CAAAATAATTCGTTATAATTGGG + Intergenic
918267005 1:182852641-182852663 CAATATATTTAGTAAGAATAAGG - Intronic
919132752 1:193472115-193472137 CACAATGATTAGTCACAGTAGGG - Intergenic
919280187 1:195481062-195481084 CAAAATATTTAGCCAAAGTAAGG - Intergenic
919446802 1:197715230-197715252 CAAAATATTTAATTATAGAAAGG - Intronic
1062781493 10:214236-214258 AAAAGTAATTATTTAAAGTAAGG + Intronic
1063302207 10:4860234-4860256 TAAAATAATGAGTTAGAGGCTGG + Intergenic
1070377867 10:75851757-75851779 CAAAATAATTAATAGGAGCATGG - Intronic
1070869170 10:79733411-79733433 CAAAATAATGTGTGAGTGTAGGG - Intergenic
1071081361 10:81816005-81816027 TAAGATAAATAGTTAGAGCATGG + Intergenic
1071636084 10:87255586-87255608 CAAAATAATGTGTGAGTGTAGGG - Intergenic
1071659157 10:87482358-87482380 CAAAATAATGTGTGAGTGTAGGG + Intergenic
1071802432 10:89078563-89078585 GAAAATAATAATTTAGAGTTTGG + Intergenic
1073706894 10:105994030-105994052 CAAAATAATAGGTTAGACTAAGG + Intergenic
1073882590 10:108000535-108000557 GAAAAAAATTAGTCAGAGTCTGG - Intergenic
1078112255 11:8405704-8405726 CACAAAAATTAGTTTGAGAAGGG - Intronic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079709033 11:23657522-23657544 AAAAATCATAATTTAGAGTAAGG - Intergenic
1079789580 11:24719350-24719372 GAAAATAATTAGTTAAATCATGG + Intronic
1080018557 11:27533937-27533959 GAGAAAAATAAGTTAGAGTAAGG + Intergenic
1080950232 11:37023919-37023941 CAGATTAATTAGTTAAATTAGGG + Intergenic
1081401532 11:42648751-42648773 GTAACTAATTAGTTGGAGTAAGG - Intergenic
1083213721 11:61205452-61205474 CAAATTAATTAATTGGACTATGG + Intronic
1084371170 11:68744990-68745012 CAAAATAATTATCTACAGTCAGG - Exonic
1085212350 11:74792383-74792405 CAAAAGACATAGTAAGAGTAGGG + Intronic
1086525632 11:87722811-87722833 CAAGAGAATTAGTTAGGGTAAGG + Intergenic
1087058463 11:93956058-93956080 CAGATTAAGTAGTTAGATTATGG - Intergenic
1087693071 11:101344705-101344727 CAAAATGTTTATTTAAAGTATGG - Intergenic
1089316541 11:117594968-117594990 CAGAACAGTTAGTTAGAGAACGG - Intronic
1090221207 11:125027994-125028016 CAAAATCATAAGGTAGGGTAAGG - Intronic
1090547920 11:127785510-127785532 GCAAATAGTTACTTAGAGTAAGG + Intergenic
1090558412 11:127901798-127901820 GAAAATAATTGCTTAGAATATGG + Intergenic
1090617454 11:128528206-128528228 CAAGACAATTAATTAAAGTATGG - Intronic
1092762210 12:11820419-11820441 TAAAATTATTAGGTAGATTAGGG + Intronic
1093554284 12:20452303-20452325 CAAAATAATTTTTTAGAATTTGG + Intronic
1094290777 12:28846963-28846985 CAAAATAAATAATTACAGCATGG + Intergenic
1097479943 12:60111020-60111042 GAAAAAAATTAGTAAAAGTATGG - Intergenic
1098373654 12:69788197-69788219 CAAAATAATGATTTAAAATAGGG - Intronic
1099448825 12:82784242-82784264 CAAAATAATTAACTGGGGTATGG - Intronic
1102112939 12:110378846-110378868 AAAAAAAAATAGTTAGAGTTAGG - Intronic
1102150463 12:110686302-110686324 CAAAATAATTTTTTAGAATTAGG - Intronic
1104308784 12:127634966-127634988 CAAACTAATTTGTGAGAGGACGG - Intergenic
1105791574 13:23805445-23805467 CAAAGGAATTAGATAGAGTCTGG + Intronic
1106295301 13:28408195-28408217 CAAAGAAATATGTTAGAGTAAGG + Intronic
1107369416 13:39727344-39727366 CAATCTAGTTATTTAGAGTATGG + Intronic
1108756324 13:53507358-53507380 GAAAATAATTAGTTAGTGATTGG + Intergenic
1110003509 13:70235814-70235836 AAAAATAATAAATTAGAATATGG - Intergenic
1111061473 13:83024721-83024743 GAAAAAAATGAATTAGAGTAAGG - Intergenic
1112881721 13:104115061-104115083 CAAAACAATTTGGTAGAGCAAGG + Intergenic
1115102838 14:29723806-29723828 CAAAATAGCTGGTAAGAGTAAGG + Intronic
1115377629 14:32695109-32695131 CAAAATAAATCATTAGAATAAGG - Intronic
1115424167 14:33235941-33235963 AAAAATAATTAGTCAGACTTGGG - Intronic
1115560467 14:34578325-34578347 CAAAATAAAAAATTAAAGTAAGG + Intronic
1116143909 14:41038405-41038427 CAAAAAAATTAGGTATAGTGTGG + Intergenic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116911533 14:50471209-50471231 CCAAATATTTAGTGATAGTAAGG + Intronic
1117295711 14:54377462-54377484 CAAAATATTTAGGTACAGTGAGG - Intergenic
1118695226 14:68378180-68378202 AAAAGTAATTAGGTTGAGTAGGG - Intronic
1120153069 14:81059201-81059223 AAAAATAATTAGTGAGGGCATGG - Intronic
1120245394 14:81999757-81999779 CAAAATAATTAGTTGCAGCTCGG - Intergenic
1125846374 15:42858526-42858548 CATAATAAAAAATTAGAGTAAGG + Intronic
1126592008 15:50349589-50349611 CAAAATAATTGATTATGGTAGGG + Intronic
1126995883 15:54444670-54444692 CAAAAAAATTAGGAAGAGAAAGG - Intronic
1128016693 15:64354504-64354526 CAAAATAATAAAGTAGAATATGG - Intronic
1128848178 15:70920547-70920569 CAAAAAGCTTTGTTAGAGTAGGG + Intronic
1128868206 15:71132047-71132069 ATAAGTAATTAGTTAGGGTAGGG - Intronic
1131898081 15:97055565-97055587 CTAAATATTTAATTAGCGTATGG - Intergenic
1138039500 16:53647590-53647612 CCAAATCATTAGTTATAATAGGG + Intronic
1138171325 16:54852332-54852354 AATAAGAATTAGTTAGAGTGTGG + Intergenic
1138278644 16:55755705-55755727 AAGAATTATTAGTGAGAGTAGGG - Intergenic
1139031023 16:62880752-62880774 AAAAATAATTAGTCAGATTCTGG - Intergenic
1139397985 16:66655815-66655837 CAAAATAAATAATTATAGTTTGG + Intronic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1143995285 17:11001375-11001397 TAAAATAATTAGTAAGACTGTGG - Intergenic
1144416199 17:15049788-15049810 CAAAATTATCATTCAGAGTAAGG + Intergenic
1144416669 17:15054392-15054414 AAAAATAATTTGTTATATTATGG - Intergenic
1147729960 17:42593277-42593299 CAAAAAAATCAGTAAGTGTAAGG + Intronic
1149169299 17:53791387-53791409 AAAAACAATTTGTTAGAGTTGGG - Intergenic
1149374356 17:56029426-56029448 CAAAATAATTAGTAAGGAGAAGG + Intergenic
1150526901 17:65932963-65932985 CAAAAGAATTAGTTTGACAAAGG + Intronic
1152143710 17:78554504-78554526 TAAATTAATTTCTTAGAGTAGGG - Intronic
1152268857 17:79312095-79312117 GAAAACGATTAGTTACAGTACGG - Intronic
1155301368 18:24432458-24432480 CAAAATACTTAATTAGAAAATGG + Intronic
1155601574 18:27554829-27554851 CAAAATAATTATGTGGACTAAGG - Intergenic
1155817958 18:30339000-30339022 TAAAATAATATGTTTGAGTAGGG + Intergenic
1157241745 18:46016363-46016385 CAAAATAAATAAATAAAGTATGG + Intronic
1158325340 18:56307833-56307855 CAAAATAATTAATTTGAGTCTGG + Intergenic
1158473211 18:57757177-57757199 CAAAATAATTATGGACAGTAAGG - Intronic
1163999468 19:21083618-21083640 AAAAATAATTAATTAAAATATGG - Intronic
1164026894 19:21360781-21360803 AAAAATAATTAATTAAAATACGG - Intronic
1167087884 19:47323042-47323064 CAAAAAAATTAGTCTGAGCATGG + Intergenic
1167971689 19:53191848-53191870 AAAAAAAATTTGTTAGATTATGG + Intronic
925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG + Intronic
925551123 2:5075966-5075988 CACATTAATTAGTTAAAGTGAGG + Intergenic
925679662 2:6406429-6406451 CTAAATAATTAGATATACTAAGG - Intergenic
926879533 2:17528328-17528350 CACAAAAATTAGTTTAAGTATGG + Intergenic
926965727 2:18408480-18408502 CGAAATGATTACTTTGAGTATGG + Intergenic
927579874 2:24232968-24232990 CATAAAAAAGAGTTAGAGTAAGG - Intronic
928221323 2:29405608-29405630 CAAAATAAATAGGTAAAGGAGGG - Intronic
929643159 2:43601997-43602019 AAAAATAATTATTTAGAGTTGGG + Intergenic
930111055 2:47679009-47679031 CTAACTAGTTAGTTACAGTATGG - Intergenic
930360576 2:50373213-50373235 TAATATAATTACTTAGATTAGGG + Intronic
931446213 2:62329414-62329436 AAAAATATTTAGTGAGTGTAAGG - Intergenic
935463182 2:103362974-103362996 CTAAATATTTACTAAGAGTAGGG + Intergenic
937629237 2:124081128-124081150 CAAAATTTTTACTTATAGTAAGG - Intronic
938968874 2:136413954-136413976 CAAAATAAATAGTAATAGAAGGG + Intergenic
939435694 2:142174698-142174720 CAAAAGAATCATTTTGAGTAAGG - Intergenic
941280231 2:163540726-163540748 CAAAACAATTAGCTGGAGTGTGG + Intergenic
941491708 2:166150489-166150511 CAAAATAACAAGTTAGTGTCAGG - Intergenic
942705946 2:178772645-178772667 GGAAATAATTCTTTAGAGTAAGG + Intronic
942781549 2:179648795-179648817 CAAAATAATTGATGATAGTAAGG + Intronic
943192203 2:184693222-184693244 AAAAATAATTATTTAGAATAAGG + Intronic
944776565 2:202972769-202972791 CACAATAATCAGTAAGAGCAAGG - Intronic
945635880 2:212350111-212350133 CCAAGTTATTAGTTAGTGTAAGG + Intronic
946999405 2:225436549-225436571 CAATATAATTAGGTAAAATAAGG - Intronic
1169939341 20:10919966-10919988 CAAAATAATTAGTCAGCAAATGG - Intergenic
1170205648 20:13795302-13795324 CAAAATAATAAGTTACATTGGGG + Intronic
1171004481 20:21450861-21450883 CAAAATAATTAAGTATAGTAAGG + Intergenic
1173072711 20:39784855-39784877 AAAAATATTTATTTAGAGTCTGG - Intergenic
1174628596 20:51936672-51936694 CAAAATAAAAAGTTACAATAGGG + Intergenic
1175556600 20:59864272-59864294 AATAATAATTAGATAAAGTATGG + Exonic
1176695209 21:9968883-9968905 AAAAAAGATTAGTTTGAGTATGG - Intergenic
1177371627 21:20211394-20211416 TAAAATATTTAGGAAGAGTATGG + Intergenic
1177547934 21:22583303-22583325 CTAAATAATTGTTTAGAATATGG + Intergenic
1177801025 21:25828906-25828928 CTGAATAATTGGTTGGAGTAGGG - Intergenic
1177923236 21:27181173-27181195 TTAAAAAATTAGTTAGAGGAGGG - Intergenic
1177957770 21:27622082-27622104 AAAATTTATTAGTTAAAGTAAGG + Intergenic
1178134972 21:29616708-29616730 CAAAAGACTTAATTAGACTATGG + Intronic
1180662697 22:17482495-17482517 TAAAATAATGATTTAAAGTACGG - Intronic
1183025388 22:35061902-35061924 CAAAATAATAAGCTAGAGAGAGG - Intergenic
1183616746 22:38950367-38950389 GAAAATAATTATTTAGTGGAGGG + Intergenic
949272103 3:2230068-2230090 CAAAACAAGTAAATAGAGTAGGG - Intronic
949695265 3:6687099-6687121 CAAAATATGTACTTAAAGTAAGG - Intergenic
951487396 3:23229151-23229173 AAATATAATTAATTATAGTAGGG + Intronic
951511332 3:23506004-23506026 CATAATAATAATCTAGAGTAAGG - Intronic
954893574 3:53955481-53955503 CAAAAGAATAAGGTAGAGTTAGG + Intergenic
955933778 3:64082956-64082978 TAAAATCCTTAGTTAGAGTGGGG - Intergenic
957587521 3:82151254-82151276 CAAAATATTTTGGTTGAGTAGGG - Intergenic
958268319 3:91466383-91466405 TAAAATAATTTGTTAGAGTGGGG - Intergenic
958511434 3:95054654-95054676 CAAAATAAATAATTATAGTGTGG + Intergenic
959121242 3:102235025-102235047 CAAAATAATTACATAGATTGTGG - Intronic
960445106 3:117738601-117738623 TAAAATAATTGCATAGAGTATGG + Intergenic
960833345 3:121875593-121875615 CAAAATTAACAGTTAGAGCAGGG + Intronic
960884623 3:122381863-122381885 CATCAGAATTAGTTATAGTAAGG - Intronic
964034510 3:152179610-152179632 GAAAGTGATGAGTTAGAGTAAGG - Intergenic
966026745 3:175293151-175293173 CAAGATAATTAGTTGGAGTTAGG - Intronic
966376948 3:179306040-179306062 AAAAACAATTTGTTACAGTAAGG + Intergenic
966377020 3:179306767-179306789 CTAAATTACTAGTTAGATTAGGG - Intergenic
967677648 3:192318295-192318317 CAAAATAATTGTTTTGAGGAAGG + Intronic
971954799 4:33402434-33402456 AAAAATAAAAAGTTAGAGTGAGG + Intergenic
971992845 4:33923560-33923582 GAAAATAATTAGTGAGAAAATGG - Intergenic
972228357 4:37041431-37041453 CAGAATAAAAAATTAGAGTAAGG + Intergenic
972981230 4:44704539-44704561 CAAAATAATTATTTCTAGTTTGG - Intronic
974510933 4:62839596-62839618 CAAAACTATTAGCCAGAGTAGGG - Intergenic
974748599 4:66107137-66107159 CAAAAAAATGAGTTATAATAAGG - Intergenic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
975718040 4:77224579-77224601 CAAAATGATAGGTTAGAGGATGG + Intronic
975886199 4:78968524-78968546 CAAAATAAATAGATATATTAAGG + Intergenic
977202089 4:94129543-94129565 CAAAATACTTAGGTTAAGTAGGG + Intergenic
977752155 4:100622135-100622157 GAAAATAATTAGTGAGACTAAGG + Intronic
978008839 4:103653281-103653303 CTAAATAAATGGTGAGAGTAAGG - Intronic
980008894 4:127573931-127573953 CAAAAAAATTAGTAACAATATGG - Intergenic
980030857 4:127828230-127828252 GAGAATATTTACTTAGAGTAGGG - Intronic
980275768 4:130648207-130648229 CAAAACAATTACTCAGAGGAAGG + Intergenic
980311113 4:131129871-131129893 CACAAGAATTAGTAGGAGTATGG - Intergenic
980473775 4:133283045-133283067 CAAAATTATTAGTTACAATAAGG - Intergenic
980817234 4:137964573-137964595 TAAAATACTAAGTTAAAGTAGGG + Intergenic
980929834 4:139175267-139175289 CAAAATAGTCAGCTTGAGTATGG - Intronic
982688741 4:158524594-158524616 CAATACAATTAATTAGACTATGG - Intronic
982739379 4:159041955-159041977 CAAAATAATTAGCCAGATTTGGG - Intergenic
983337724 4:166418159-166418181 AAATATTATTAGTTAGAGTTTGG - Intergenic
983359505 4:166710154-166710176 TCAAATGATTAGTTAGAGTGGGG - Intergenic
983529657 4:168796209-168796231 TAAAAAAATTAGTTAGAGCTGGG - Intronic
984810807 4:183795377-183795399 TAAAATAATAATTTATAGTAGGG + Intergenic
986702019 5:10419700-10419722 CAAAATAATTGATTATAGCAAGG + Intronic
987801464 5:22702166-22702188 CACAATGAGTAGTTAGTGTAAGG - Intronic
987881580 5:23752674-23752696 CTAAATAATTACTTAGATTTGGG + Intergenic
988056892 5:26108817-26108839 GAAAATAATTACTTAGAGAAGGG + Intergenic
990258231 5:53993756-53993778 CATCATGATTAGTTAGAGTCAGG + Intronic
990310815 5:54536194-54536216 AAAAATAATTATTTAAAGTGAGG - Intronic
990856477 5:60272996-60273018 CAAAATACCCAGTTAGTGTAAGG - Intronic
991246007 5:64508638-64508660 CAAGATAAGTACTTAGAGCAAGG + Intronic
992559630 5:77937895-77937917 CAAAATGATCATTTAGAATAAGG + Intergenic
992968212 5:82025725-82025747 CAAAATAATTAGTGAATCTAGGG - Intronic
993069574 5:83143249-83143271 GAAAATACTTAGGTATAGTAAGG + Intronic
993195002 5:84730624-84730646 CAAAAGAATAAGTTTGAGAAGGG - Intergenic
993304551 5:86259209-86259231 CTGAATAAGTAGTTAGAATAAGG + Intergenic
993563122 5:89437116-89437138 CAAAATAATTAGATATATTATGG - Intergenic
993802588 5:92361473-92361495 GGAAATAATTAGTTAGAATAAGG - Intergenic
993885563 5:93411669-93411691 CAAAGTCATTATTTAAAGTAGGG - Intergenic
994526027 5:100905251-100905273 AAAAATAATAATTTACAGTATGG + Intergenic
994679220 5:102865053-102865075 CAACATAATTAGAAAGAGTAGGG - Intronic
995068211 5:107886667-107886689 CAAAATAAATAATGATAGTATGG + Intronic
995313767 5:110742401-110742423 CAAAATAATAATTTAGAATGGGG + Intronic
995981804 5:118113374-118113396 AAATATATTTAGTTAAAGTAAGG - Intergenic
996074603 5:119176218-119176240 AAAAAAAATTATTTTGAGTATGG + Intronic
996357268 5:122610272-122610294 CAAAATAATTGGTTTTTGTAAGG + Intergenic
996537054 5:124588812-124588834 GAAAATAACTAGATAAAGTAAGG - Intergenic
996634137 5:125669867-125669889 AAAAATAATTATTTTGAGAAGGG - Intergenic
1000884019 5:166730396-166730418 CAAAGTCATTAATTAGAATAAGG + Intergenic
1000988435 5:167886591-167886613 CAAAATAATTAGCTATAAAAAGG + Intronic
1001539728 5:172529321-172529343 CAAATTAATGGTTTAGAGTAAGG + Intergenic
1001996572 5:176165328-176165350 CAATATATTTAGTTTGAATACGG - Intergenic
1002826090 6:775678-775700 CAAAAAAATAAGTCAGAGTTGGG - Intergenic
1003013012 6:2444054-2444076 CATAATAAATAGAGAGAGTAGGG + Intergenic
1004910620 6:20279335-20279357 CAAAATATTTAGTCAGACTATGG - Intergenic
1006213711 6:32420090-32420112 CTAGATAATTCCTTAGAGTAAGG + Intergenic
1006254772 6:32821992-32822014 CAAAAGAAATAGTTAGAATTTGG + Intronic
1006971695 6:38051971-38051993 AAAAAAAATTATTTGGAGTAAGG - Intronic
1008464998 6:51820602-51820624 CAAAAAAATTATTTAGAGAATGG + Intronic
1008892950 6:56517064-56517086 AAAAATAATTAGTTTAAATAAGG - Intronic
1008986883 6:57555204-57555226 TAAAATAATTTGTTAGAGTGGGG + Intronic
1009174841 6:60447763-60447785 TAAAATAATTTGTTAGAGTGGGG + Intergenic
1010332269 6:74637287-74637309 CCAAATAAGTAGTTAAAGAACGG + Intergenic
1011940288 6:92834481-92834503 CATCATAATTAACTAGAGTAGGG - Intergenic
1013707428 6:112854586-112854608 CAAAATAAGTACCCAGAGTATGG - Intergenic
1014256516 6:119165577-119165599 TAAAAGAATTACTTAGAGAAAGG - Intergenic
1014274050 6:119366702-119366724 CAAAATAGGTGGTTAAAGTAGGG - Intergenic
1014714884 6:124852005-124852027 CAGAATAATGAGTTAGAAAAAGG + Intergenic
1014982557 6:127962099-127962121 TAAAATAATTCTGTAGAGTATGG - Intergenic
1015206909 6:130650527-130650549 CAAAATAAGTAGCAAGAGGAAGG + Intergenic
1015851898 6:137582822-137582844 AATAATAATTACTTAGAGAAAGG + Intergenic
1016165954 6:140944108-140944130 CAGAATAATTGGTCAGTGTATGG + Intergenic
1016260500 6:142163969-142163991 CAAAACAATTGGCTAGAGTATGG - Intronic
1016400369 6:143673486-143673508 CAAAATAATTGCTTCCAGTAAGG - Intronic
1016686060 6:146883838-146883860 CATATTAATTAGCTAGAGCATGG + Intergenic
1017790842 6:157797806-157797828 CAAAATAAGTAACTATAGTAAGG + Intronic
1018449180 6:163890780-163890802 TAATATAATTAGTAAGAGTTGGG + Intergenic
1018831904 6:167449658-167449680 CAGAGTAATTTGTAAGAGTAGGG - Intergenic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1020553582 7:9640257-9640279 CAAAATAATTATTCAGACAATGG - Intergenic
1020601896 7:10286016-10286038 AAAAATATTTATTTAAAGTAAGG + Intergenic
1024390792 7:48810137-48810159 GAAAAAAATAAGTTAAAGTACGG - Intergenic
1024894749 7:54244999-54245021 CAAAATCATCAGTTGGAATATGG - Intergenic
1026637083 7:72093555-72093577 TACAATAATTATTTAAAGTAAGG + Intronic
1027389451 7:77690938-77690960 AAAAATAATAAGTCAGAGTCAGG - Intergenic
1030831408 7:114226503-114226525 CCAAATAAATATTTAGAGAAAGG - Intronic
1033064217 7:138138102-138138124 TAAAATAATTACTGAAAGTAAGG + Intergenic
1036121612 8:6023820-6023842 CAAAAAAATTGGTAAGAGTTTGG - Intergenic
1036479233 8:9123488-9123510 CAAAGTAATTAATGAGAGTAAGG - Intergenic
1036734707 8:11301845-11301867 CGAAATAATTACTCAGAATATGG + Intronic
1037864061 8:22428799-22428821 CAAAATCATCAGTTAGATCAAGG - Intronic
1039289199 8:36075733-36075755 CAAATTAAAAAGTTTGAGTAAGG - Intergenic
1040636641 8:49282737-49282759 TAAAATAATTATTTAAATTAAGG + Intergenic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1043859243 8:85296733-85296755 AAAAATAATAAATCAGAGTAAGG - Intergenic
1043984395 8:86676557-86676579 GAAGATAATTAGTTGCAGTAAGG + Intronic
1044446311 8:92280882-92280904 CAAAATAATTAGAGAAAGAAAGG + Intergenic
1046173867 8:110549010-110549032 CAAAATAATTACCTAGATTCTGG - Intergenic
1046480087 8:114805016-114805038 TAAACTAATTAGTTAGAAAAAGG - Intergenic
1046963498 8:120135971-120135993 CTAAATTATTAGTTCAAGTAGGG + Intronic
1050654658 9:7813754-7813776 CAAAATAATTTGCTAGTGGATGG + Intronic
1050827848 9:9971544-9971566 GAAACTAATGAGTTAGATTATGG + Intronic
1052184508 9:25575483-25575505 CAAAATAATTAGTAAAAGGAGGG - Intergenic
1052489417 9:29145442-29145464 CAAAATAATGTGTTAGAAAATGG - Intergenic
1052598041 9:30586799-30586821 CAATATAATTAGTCAGAGAAAGG + Intergenic
1053017748 9:34673063-34673085 CAAAAAGATTAGTCAGAGCATGG + Intergenic
1053632187 9:39954830-39954852 AAAAAAGATTAGTTTGAGTATGG - Intergenic
1053773578 9:41508705-41508727 AAAAAAGATTAGTTTGAGTATGG + Intergenic
1054211701 9:62295868-62295890 AAAAAAGATTAGTTTGAGTATGG + Intergenic
1054313281 9:63552961-63552983 AAAAAAGATTAGTTTGAGTATGG - Intergenic
1055668039 9:78571564-78571586 CAAGGTAATGAGTTAGAGGAGGG - Intergenic
1056056913 9:82834118-82834140 CAAAATAATTAGGCAGGTTATGG - Intergenic
1056114792 9:83431506-83431528 CAAAGTAAAAAGTTAGAATAGGG - Intronic
1058206521 9:102115633-102115655 CAAAAGAATTAAATAGGGTAAGG + Intergenic
1059214613 9:112549336-112549358 AAAAATAATTTGTAATAGTACGG - Intronic
1060760275 9:126241331-126241353 AAAAACAATTAGTAAGAGAATGG - Intergenic
1061147994 9:128811387-128811409 CAAAAAAATTATTTAGAGCCGGG + Intergenic
1061665434 9:132158256-132158278 CATAATAATTAATGGGAGTATGG + Intergenic
1061858967 9:133458196-133458218 CAAAATCATTAGTGAAAGAATGG + Intronic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1186975528 X:14898974-14898996 GAAAATCATTTGTTAGAGTTGGG + Intronic
1187318134 X:18217459-18217481 TAAAATAATTAGCTAGTGTGAGG + Intronic
1187617101 X:21007998-21008020 TCAAATGATTAGTTAGACTAAGG - Intergenic
1187649721 X:21389203-21389225 CATGATAATTAGTTATATTATGG + Intronic
1187678240 X:21739243-21739265 CTAAGTAATTTGTTAGAGTTTGG - Intronic
1188391986 X:29632027-29632049 CTATATAATTAGTCACAGTAAGG - Intronic
1188693779 X:33162427-33162449 AAAAATAATTAGTAAGAAAATGG + Intronic
1188877185 X:35444398-35444420 CAAAATATTGAGTAAGAGAAGGG - Intergenic
1189460070 X:41233909-41233931 CAAAATATTTAAATAGAATAGGG - Exonic
1190226166 X:48547087-48547109 CAAAATAATCCTATAGAGTAGGG + Intronic
1190594177 X:52036496-52036518 CAATATAATCATTTAGAGTAAGG - Intergenic
1192142240 X:68655605-68655627 CAAAATAATAAGTTGTGGTAAGG + Intronic
1192786664 X:74342910-74342932 CCAAAAAATTCTTTAGAGTATGG - Intergenic
1193525638 X:82584744-82584766 AAATATAATTAGTTAAAATATGG - Intergenic
1194884968 X:99303170-99303192 CAAAATATTTTGTAAGATTATGG + Intergenic
1196246026 X:113401581-113401603 CAAAATTATTAGTTGGTGTGTGG + Intergenic
1197852166 X:130874178-130874200 CACACTTCTTAGTTAGAGTATGG - Intronic
1198645993 X:138807108-138807130 CAGATTACATAGTTAGAGTAGGG - Intronic
1201408123 Y:13669592-13669614 AAAAATAATTGGTTAGAACAAGG - Intergenic