ID: 1140602914

View in Genome Browser
Species Human (GRCh38)
Location 16:76500050-76500072
Sequence CCCAACAGCTCATTGAGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2279
Summary {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140602914_1140602918 -6 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602918 16:76500067-76500089 GTTGGGTACACCTCCCTGACGGG 0: 4
1: 1004
2: 905
3: 379
4: 126
1140602914_1140602921 1 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602921 16:76500074-76500096 ACACCTCCCTGACGGGGTGGCGG 0: 3
1: 1346
2: 867
3: 2126
4: 2068
1140602914_1140602925 6 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602925 16:76500079-76500101 TCCCTGACGGGGTGGCGGCGGGG 0: 1
1: 48
2: 1548
3: 4235
4: 4290
1140602914_1140602928 12 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602928 16:76500085-76500107 ACGGGGTGGCGGCGGGGCAGAGG 0: 18
1: 1456
2: 2564
3: 2617
4: 3326
1140602914_1140602929 13 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG 0: 4
1: 243
2: 1261
3: 1200
4: 2097
1140602914_1140602917 -7 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602917 16:76500066-76500088 TGTTGGGTACACCTCCCTGACGG 0: 5
1: 1078
2: 775
3: 169
4: 316
1140602914_1140602919 -5 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602919 16:76500068-76500090 TTGGGTACACCTCCCTGACGGGG 0: 4
1: 933
2: 947
3: 414
4: 129
1140602914_1140602923 4 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602923 16:76500077-76500099 CCTCCCTGACGGGGTGGCGGCGG 0: 1
1: 46
2: 75
3: 80
4: 290
1140602914_1140602924 5 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602924 16:76500078-76500100 CTCCCTGACGGGGTGGCGGCGGG 0: 1
1: 384
2: 3572
3: 3178
4: 2240
1140602914_1140602920 -2 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602920 16:76500071-76500093 GGTACACCTCCCTGACGGGGTGG 0: 4
1: 925
2: 1037
3: 221
4: 126
1140602914_1140602930 14 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602930 16:76500087-76500109 GGGGTGGCGGCGGGGCAGAGGGG 0: 6
1: 297
2: 1350
3: 1531
4: 2710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140602914 Original CRISPR CCCAACAGCTCATTGAGAAC GGG (reversed) Intronic
Too many off-targets to display for this crispr