ID: 1140602929

View in Genome Browser
Species Human (GRCh38)
Location 16:76500086-76500108
Sequence CGGGGTGGCGGCGGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4805
Summary {0: 4, 1: 243, 2: 1261, 3: 1200, 4: 2097}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140602912_1140602929 28 Left 1140602912 16:76500035-76500057 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG 0: 4
1: 243
2: 1261
3: 1200
4: 2097
1140602914_1140602929 13 Left 1140602914 16:76500050-76500072 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG 0: 4
1: 243
2: 1261
3: 1200
4: 2097
1140602916_1140602929 12 Left 1140602916 16:76500051-76500073 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG 0: 4
1: 243
2: 1261
3: 1200
4: 2097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140602929 Original CRISPR CGGGGTGGCGGCGGGGCAGA GGG Intronic
Too many off-targets to display for this crispr