ID: 1140610030

View in Genome Browser
Species Human (GRCh38)
Location 16:76587209-76587231
Sequence CAGGCTTAAGTGAAGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140610030 Original CRISPR CAGGCTTAAGTGAAGTTTTG AGG Intronic
901165613 1:7219684-7219706 TAGGTTTAGGTGAAGTTGTGAGG + Intronic
901266958 1:7918421-7918443 CAGGCTGAAGTGTAGTGATGCGG + Exonic
901719157 1:11181478-11181500 CAGGCTTGAGTGTAGTGGTGGGG - Intronic
902771019 1:18645727-18645749 CAGACTTAAGGCAAGTTTTCAGG - Intronic
903707609 1:25298423-25298445 CAGGCTGAATTGAAGTTTTGAGG - Intronic
903719632 1:25394931-25394953 CAGGCTGAATTGAAGTTTTGAGG + Intronic
905795293 1:40812650-40812672 CAGGGAGAAGTGAAGTTTGGGGG + Intronic
906492350 1:46278516-46278538 CAGGCTTTAGAGAAGTATAGGGG - Exonic
908522750 1:64960181-64960203 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
908593518 1:65659120-65659142 CATGCTTTACTGAATTTTTGAGG + Intergenic
909098405 1:71319054-71319076 CAGGGTCAAGTGAAGTTTCTTGG + Intergenic
909106804 1:71420557-71420579 CAGGGTTAAAAGAAATTTTGAGG + Intronic
909659600 1:78067494-78067516 CAGGCTGAAGTGTAGTGTCGTGG + Intronic
910175605 1:84427121-84427143 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
910375091 1:86559750-86559772 CAGGAATAAGTGATGGTTTGGGG + Intronic
913488296 1:119354305-119354327 CAGGGCTCAGTGAAGCTTTGGGG + Intergenic
913662688 1:121018698-121018720 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
914014071 1:143801958-143801980 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
914163750 1:145159242-145159264 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
914652689 1:149710513-149710535 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
915591928 1:156875645-156875667 CAGGCATCACTGAAGTATTGTGG - Exonic
915670871 1:157487837-157487859 CATGTTTAAGTGAAGTCATGAGG + Intergenic
917363152 1:174199334-174199356 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
917467655 1:175296519-175296541 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
917587184 1:176439114-176439136 GTGGCTTAAGTGGACTTTTGGGG - Intergenic
920048338 1:203148174-203148196 CAGGCTTGAGTGCAGTGGTGCGG - Intronic
920106915 1:203560036-203560058 CAGGCTAAAGTGGAGTGGTGCGG - Intergenic
920338307 1:205259532-205259554 CAGGCTTAAGTGAAGCTGTGTGG - Intronic
920455855 1:206100574-206100596 CAGGCTCTGGTGAAGCTTTGGGG - Intronic
921266709 1:213426434-213426456 CAGACTCAAGTGAGTTTTTGCGG + Intergenic
922371406 1:224913738-224913760 CAGGCTGGAGTGCAGTGTTGTGG - Intronic
922555972 1:226532251-226532273 CAGGCTGGAGTGTAGTTGTGCGG + Intergenic
922914594 1:229246058-229246080 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
924783455 1:247172728-247172750 CACACTGAAGTGCAGTTTTGAGG + Intergenic
1063954442 10:11253279-11253301 CAGGCTTAAGTGACATTTCTGGG - Intronic
1064363798 10:14689333-14689355 CAGGCTAAAGTGCAGTGGTGCGG - Intronic
1065214324 10:23435957-23435979 CAGGCTAAAGTGCAATTGTGTGG + Intergenic
1065699340 10:28409839-28409861 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
1065961907 10:30740456-30740478 CAGGAGCAAGTGCAGTTTTGTGG + Intergenic
1067962732 10:50874636-50874658 CAGATTACAGTGAAGTTTTGGGG - Intronic
1068279278 10:54848006-54848028 CAGTGTTAAGTGAAGTATTTGGG + Intronic
1070193133 10:74131065-74131087 CAGGCTGTAGTGCAGTGTTGTGG - Intronic
1070639706 10:78158838-78158860 CAGGCTAGAGTGAAGTGGTGTGG + Intergenic
1070855096 10:79602216-79602238 CATGCTTTACTGAGGTTTTGAGG - Intergenic
1071731480 10:88253032-88253054 TAGGCTGAAGTGAATTTTTCTGG + Intergenic
1072483647 10:95833235-95833257 CATTTTTAAGTGCAGTTTTGTGG - Intronic
1072641216 10:97212603-97212625 CAGGCTAAAGTGTATATTTGGGG - Intronic
1073270306 10:102257351-102257373 CAGGCTGGAGTGCAGTTGTGGGG + Intronic
1073380629 10:103075437-103075459 GAGTCTTCAGTGAGGTTTTGTGG - Intronic
1075207955 10:120462910-120462932 TTGTGTTAAGTGAAGTTTTGGGG + Intronic
1075523553 10:123162097-123162119 CAGGCTTTAATGAAGTGTTTAGG - Intronic
1075670446 10:124260726-124260748 CAAGCTTTAGTGGAGTGTTGGGG - Intergenic
1078222956 11:9366560-9366582 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
1078262305 11:9721514-9721536 CAAGCTCAAGTGCAGTGTTGTGG + Intronic
1081836458 11:46159559-46159581 GGGGCTTAAGGGAACTTTTGGGG + Intergenic
1082738891 11:56888271-56888293 CCGGTATAAGTGAGGTTTTGGGG - Intergenic
1082838046 11:57666237-57666259 CAGGCTGGAGTGAAGTTGTGTGG + Intergenic
1085019087 11:73193815-73193837 CAGGCTTCAGTGAATATTAGTGG + Intergenic
1085259796 11:75197940-75197962 CAGGCTGTAGTGAAGCTTGGGGG + Intronic
1085674687 11:78504941-78504963 CAACCTTAAGTGCAGTTCTGGGG - Intronic
1086901729 11:92375176-92375198 CAGGCTGGAGTGCAGTTGTGGGG + Intronic
1089293460 11:117452973-117452995 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1092374907 12:7947377-7947399 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
1093042732 12:14402651-14402673 CTGGCTGAAGTGAAGTGGTGCGG + Intronic
1093582577 12:20800193-20800215 ATGGTTTAAGTGAAATTTTGTGG + Intergenic
1094255682 12:28423272-28423294 CAGGCTAAACTTAACTTTTGAGG + Intronic
1094366422 12:29687904-29687926 TAGGGTTAAGTGAAGTTGTAAGG - Intronic
1095973221 12:47919531-47919553 CAGGCTGGAGTGCAGTGTTGCGG - Intronic
1096269093 12:50149777-50149799 TAGGCTGAAGTGAAGTGTGGTGG + Intronic
1096954884 12:55516225-55516247 CAGCCTTAAGTGAACATTGGTGG + Intergenic
1097724350 12:63057894-63057916 CAGGCATGAATTAAGTTTTGGGG + Intergenic
1097864105 12:64544571-64544593 CAGGCTTAAGGGCAGTGGTGCGG - Intergenic
1097921088 12:65074771-65074793 CAGGCTTGAGTGCAGTGGTGCGG - Intronic
1099268079 12:80473384-80473406 CATGCTTAAGAGCAGTTTTTAGG - Intronic
1101577404 12:106010717-106010739 AAGGCTTAATTGATGTTTTAGGG - Intergenic
1101734064 12:107449693-107449715 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1105230329 13:18488727-18488749 AAGGGTTAAGTGTAGTTTAGAGG + Intergenic
1105641174 13:22266438-22266460 AAGGCTCCAGTGGAGTTTTGGGG - Intergenic
1105655028 13:22427364-22427386 CAGTCTTAACTCCAGTTTTGGGG - Intergenic
1106004520 13:25756369-25756391 CAGGCTGGAGTGAAGTGGTGTGG + Intronic
1106244219 13:27933540-27933562 CAGGCTTGAGTGCAGTGGTGTGG + Intergenic
1106384827 13:29274156-29274178 CAGGCTGGAGTGCAGTGTTGTGG + Intronic
1107115884 13:36744772-36744794 TAGGCTTAAGAGTATTTTTGAGG + Intergenic
1107572006 13:41671627-41671649 TAGGCTTAGATGAAGTTGTGAGG + Intronic
1108847549 13:54695520-54695542 CAGACTTCAGTGAAGTACTGAGG - Intergenic
1109079038 13:57874789-57874811 CAGGCCTGTGTGAAGCTTTGTGG + Intergenic
1109698052 13:65987494-65987516 CAGGCTAGAGTGCAGTTGTGTGG + Intergenic
1110021990 13:70486349-70486371 CATGCTTAACTGAAATTCTGAGG + Intergenic
1110391412 13:74979042-74979064 CAGGCTTAAATGAAATTCAGCGG + Intergenic
1113483191 13:110636658-110636680 CAGGCATACGTGACGTTATGAGG + Intronic
1115854553 14:37616693-37616715 CAGGCTGGAGTGCAGTGTTGAGG - Intronic
1115891541 14:38035277-38035299 AAGGATTAAGTTTAGTTTTGAGG - Intronic
1117288335 14:54308795-54308817 CAGGATTGAGTGACGTTCTGTGG - Intergenic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1117732458 14:58737055-58737077 CAGGCTGGAGTGAAGTGGTGTGG + Intergenic
1120393014 14:83931564-83931586 CAGGCTTATGAAAAATTTTGAGG + Intergenic
1121118700 14:91361934-91361956 CAGCCTGGAGTGTAGTTTTGAGG - Intronic
1121543415 14:94745608-94745630 CAGGCTGGAGTGAAGTGGTGCGG - Intergenic
1121815669 14:96926240-96926262 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1122179548 14:99945181-99945203 CAGGCTGGAGTGCAGTGTTGTGG - Intergenic
1122229857 14:100300942-100300964 CAGGCTGGAGTGTAGTGTTGCGG + Intronic
1122232850 14:100315651-100315673 CAGGCTGGAGTGTAGTGTTGCGG + Intergenic
1202898010 14_GL000194v1_random:21175-21197 TAGGCTTAAGTGTACATTTGTGG - Intergenic
1124931893 15:34128356-34128378 CAGGCTAAAGTGCAGTGGTGTGG + Intergenic
1126977000 15:54194480-54194502 CAGTGTTAAATGAAGTTTTAAGG + Intronic
1127441307 15:59011505-59011527 TAGGAGTAAGTAAAGTTTTGTGG - Intronic
1130074708 15:80678771-80678793 CAGGCTGAACCGCAGTTTTGGGG - Intergenic
1130646185 15:85729267-85729289 CAGGCTGAAGTGAAGTGCAGTGG - Intronic
1133643011 16:7735851-7735873 CATGCGTAACTCAAGTTTTGTGG - Intergenic
1134864997 16:17598384-17598406 CAGTCTTAAAGGAAGATTTGAGG + Intergenic
1135647848 16:24178953-24178975 GAGGCTCAAGTGACGTTATGAGG + Intronic
1136346017 16:29676613-29676635 CAGGCTTAAGTGGAGTGCAGTGG - Intronic
1136596798 16:31256245-31256267 CAGGCTGGAGTGCAGTGTTGAGG + Intergenic
1136784932 16:32928613-32928635 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
1136884851 16:33925193-33925215 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1137293539 16:47068678-47068700 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
1137465239 16:48702401-48702423 AAGACTTCAGTAAAGTTTTGGGG - Intergenic
1139127897 16:64103336-64103358 CAGGCTGGAGTGAAGTAGTGTGG + Intergenic
1139775972 16:69317186-69317208 AAGGATTAAATCAAGTTTTGAGG + Intronic
1139796161 16:69484709-69484731 CAGGCTGGAGTGCAGTGTTGCGG + Intergenic
1139870492 16:70104622-70104644 CAGGCTGAAGTGCAGTGGTGCGG - Intergenic
1140610030 16:76587209-76587231 CAGGCTTAAGTGAAGTTTTGAGG + Intronic
1142120616 16:88384781-88384803 CAGGGTCAAGGGAAATTTTGGGG + Intergenic
1143494595 17:7305134-7305156 CAGGCTCAAGTGCAGTGGTGGGG + Intergenic
1143905294 17:10203556-10203578 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
1146074579 17:29716226-29716248 CAGGATCAAGTTAAGGTTTGGGG - Intronic
1146384805 17:32360463-32360485 CAGTATTAATTGAATTTTTGGGG + Intronic
1147396191 17:40144719-40144741 CAGGCTGGAGTGCAGTTGTGGGG + Intronic
1148272931 17:46277988-46278010 CAGGCTGAAGTGTAGTGGTGTGG + Intronic
1148547304 17:48528117-48528139 CAGGCTGGAGTGCAGTTTTTTGG - Intergenic
1149293046 17:55235617-55235639 CAGGCTGGAGTGAAGTGGTGCGG + Intergenic
1150028020 17:61698757-61698779 CAGGCTGGAGTGAAGTAGTGAGG + Intronic
1150979753 17:70127645-70127667 CAGGCTTAGGTGGAGCTCTGAGG - Intronic
1151375781 17:73687895-73687917 CAGGCTGAAGAGAGGATTTGAGG + Intergenic
1152003428 17:77661958-77661980 CAGGCTTAAGGGAAGTTGTTGGG + Intergenic
1152229088 17:79105791-79105813 CAGGCGGAAGAGAAGTTTGGAGG + Intronic
1153245580 18:3070189-3070211 CAGGCTGAAGTGAAGTGGTATGG + Intronic
1153814084 18:8778146-8778168 CAGAATTAAGTGTAGTTTGGGGG + Intronic
1153837529 18:8977306-8977328 CTGGGTTAAGAGAAGTGTTGTGG + Intergenic
1155285532 18:24285013-24285035 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1155986940 18:32239693-32239715 CAGTCTTGAGTGAGGGTTTGTGG - Intronic
1156093950 18:33507233-33507255 CATGCTTCACTGAACTTTTGGGG + Intergenic
1156712765 18:39966554-39966576 CATGTTTCAGTGAGGTTTTGGGG + Intergenic
1156791623 18:40982216-40982238 CAGGCTTGAGTGCAGTGGTGTGG - Intergenic
1157207384 18:45712107-45712129 CAGGAGTAATTGAAGTTCTGTGG - Intergenic
1157376923 18:47175828-47175850 CAGGCTGAAGTGCAGTGTCGCGG - Intronic
1157703042 18:49777042-49777064 CAGGCTGGAGTGCAGTTGTGAGG + Intergenic
1158298093 18:56021390-56021412 AATGCTTAAATGCAGTTTTGAGG - Intergenic
1159004073 18:62997578-62997600 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1160553648 18:79712324-79712346 CAGGCTTAAGTGCAGTAGTGTGG + Intronic
1160560004 18:79750222-79750244 CAGGCTGGAGTGCAGTGTTGCGG + Intronic
1161023056 19:2020508-2020530 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1161113411 19:2482542-2482564 CAGGCTGAAGTGCAGTGATGTGG + Intergenic
1163100961 19:15096202-15096224 CAGGCATAATTGAAGGTTGGGGG - Intergenic
1163827120 19:19529976-19529998 CAGGCTCATGTTGAGTTTTGGGG + Intronic
1165498469 19:36168787-36168809 CAGGCTTGAGTGCAGTGGTGCGG + Intergenic
1165646975 19:37448606-37448628 CAGGCTGGAGTGCAGTGTTGTGG + Intronic
1166626874 19:44365855-44365877 GAGGATAGAGTGAAGTTTTGTGG - Intronic
1167580304 19:50337390-50337412 AAGGCAACAGTGAAGTTTTGTGG + Intronic
1167583871 19:50362034-50362056 AAGGCAACAGTGAAGTTTTGTGG + Exonic
1168191441 19:54741293-54741315 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
1168195772 19:54772659-54772681 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
1168197666 19:54787511-54787533 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
1168204140 19:54836890-54836912 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
1168689869 19:58369699-58369721 CAGGAGTAAGTGAGATTTTGGGG - Exonic
925172139 2:1756642-1756664 CAGGCTGAACTCCAGTTTTGGGG - Intergenic
925227236 2:2194122-2194144 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
925709960 2:6729274-6729296 CTGGCTTAAGTGAGCTATTGAGG - Intergenic
926379891 2:12276489-12276511 AATGCTTAAGGCAAGTTTTGTGG + Intergenic
929245792 2:39701802-39701824 GAGGCTTAAAAGAAGTTTTGAGG - Intronic
929730461 2:44486007-44486029 CAGGCTTGAGTGCAGTGGTGCGG + Intronic
930037565 2:47096687-47096709 CAGGTTTCAGTGAATATTTGTGG - Intronic
933204783 2:79493569-79493591 CAGGCTGGAGTGCAGTGTTGCGG - Intronic
934131022 2:88948893-88948915 CAGGCATCAGTAAAATTTTGTGG - Intergenic
934135653 2:88993988-88994010 CAGGCATCAGTAAAATTTTGTGG - Intergenic
934136617 2:89001812-89001834 CAGGCAGCAGTGATGTTTTGTGG + Intergenic
934140442 2:89041816-89041838 CAGGCATCAGTAAAATTTTGTGG - Intergenic
934141000 2:89047250-89047272 CAGGCATCAGTAAAATTTTGTGG - Intergenic
934220884 2:90081675-90081697 CAGGCATCAGTAAAATTTTGTGG + Intergenic
934228234 2:90153292-90153314 CAGGCATCAGTAAAATTTTGTGG + Intergenic
934228796 2:90158720-90158742 CAGGCATCAGTAAAATTTTGTGG + Intergenic
934233525 2:90208916-90208938 CAGGCATCAGTAAAATTTTGTGG + Intergenic
934234659 2:90219781-90219803 CAGGCATCAGTAAAATTTTGTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934817827 2:97345203-97345225 GAGGCTTCAGTGCAGTCTTGGGG + Intergenic
934819869 2:97363281-97363303 GAGGCTTCAGTGCAGTCTTGGGG - Intergenic
934993742 2:98938721-98938743 CAGCCTTAAGTGCAGATTAGGGG - Intergenic
935249126 2:101246202-101246224 TAGGATTAAATGAATTTTTGGGG - Intronic
938522366 2:132083986-132084008 AAGGGTTAAGTGTAGTTTAGAGG - Intergenic
940221790 2:151360251-151360273 CAGGCTTGAGTGCAGTGGTGAGG - Intronic
943285323 2:185991311-185991333 CAGGCTGCTGTGAAGTTTTATGG - Intergenic
944515383 2:200508068-200508090 GAAGCTTTAGGGAAGTTTTGGGG + Intronic
945146057 2:206739367-206739389 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
945152516 2:206806002-206806024 CAAGCTTAAGTCATGGTTTGGGG - Intergenic
945445153 2:209928289-209928311 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
945937213 2:215915001-215915023 CAGGCTAGAGTGAAGTGGTGTGG + Intergenic
946484378 2:220086857-220086879 CAGCCCGAAGTCAAGTTTTGGGG + Intergenic
946842991 2:223836682-223836704 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
947109604 2:226705048-226705070 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
947954875 2:234180078-234180100 CAGGCTGGAGTGAAGTAATGTGG - Intergenic
948897180 2:240932968-240932990 CAGGCTGAAGGGTAGTTATGGGG + Intronic
1169068990 20:2710191-2710213 CAGGCTAAAGTGCAGTGGTGTGG + Intronic
1169458909 20:5777483-5777505 CAGGCTGAAGTGCAGTATTGTGG + Intronic
1170178070 20:13495419-13495441 CAGTATCAAGGGAAGTTTTGAGG + Intronic
1171183004 20:23104812-23104834 TAGGCTGAACTGAGGTTTTGTGG - Intergenic
1171875493 20:30571408-30571430 GAGGATAGAGTGAAGTTTTGTGG + Intergenic
1172239497 20:33402983-33403005 CAGGCTGGAGTGCAGTGTTGAGG - Intergenic
1174801620 20:53568272-53568294 CAGTTTTAAGGGAAATTTTGGGG - Exonic
1175636156 20:60586220-60586242 CAGGATTAAAGAAAGTTTTGTGG - Intergenic
1176217231 20:63953988-63954010 CAGGTTTAAGGGAAGTTTGCTGG + Intronic
1176221832 20:63973272-63973294 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1176774316 21:13117072-13117094 AAGGGTTAAGTGTAGTTTAGAGG + Intergenic
1177459128 21:21387282-21387304 TAGGTTTAAGTGACGTTATGAGG - Intronic
1178214033 21:30572882-30572904 CAGGATTTAATGAAGTTTTTAGG + Intergenic
1178549748 21:33526665-33526687 TTGGCTTAAATTAAGTTTTGGGG + Intronic
1179504388 21:41831157-41831179 CAGCTTTCAGTGCAGTTTTGGGG - Intronic
1180874275 22:19167665-19167687 CAGGCTGAAGTGCAGTGATGTGG + Intergenic
1181564945 22:23730404-23730426 CAGGCTGAAGTGCAGTATTGTGG - Intergenic
1181767743 22:25103862-25103884 CACGCTCAAGTGTTGTTTTGAGG + Intronic
1182375370 22:29843378-29843400 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
1184326476 22:43791326-43791348 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
950798135 3:15527883-15527905 GAGGCTTATGTGAAGTTCTGGGG + Intergenic
950847916 3:16032696-16032718 CAGGCTTAGGTGAAGATGTGGGG + Intergenic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
954738726 3:52729357-52729379 CAGGCTGGAGTGCAGTATTGGGG - Intronic
955720898 3:61880166-61880188 CAGGCATAATTGATGTTCTGGGG + Intronic
955820665 3:62892404-62892426 CAGAGTAAAGTGAAATTTTGGGG - Intergenic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
956198465 3:66678312-66678334 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
956468132 3:69539113-69539135 CACACATAAGTGAAGGTTTGAGG - Intronic
957902445 3:86512437-86512459 TAGGTTTACGTGAGGTTTTGAGG - Intergenic
959031953 3:101309495-101309517 CACGTTTAAGTGGAATTTTGTGG - Intronic
959283374 3:104376671-104376693 CAGGCTTAGATTAAGTGTTGAGG + Intergenic
959286990 3:104427340-104427362 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
960221631 3:115118237-115118259 CAGGCTAGAGTGCAGTTGTGTGG + Intronic
961159651 3:124712853-124712875 CATGGATAAGTAAAGTTTTGTGG - Intronic
963623950 3:147647506-147647528 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
965604649 3:170486016-170486038 AAGGCTGAAGTGAAGTCCTGGGG + Intronic
966832689 3:184023702-184023724 AACGCTTAAGAGAAGTATTGGGG - Intergenic
967863884 3:194174649-194174671 CAGGCTGAAGTGCAGTGATGTGG - Intergenic
969832040 4:9805649-9805671 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
970015923 4:11512444-11512466 CAGGCTTCAGTAGATTTTTGTGG - Intergenic
970390079 4:15600329-15600351 CTGGCTTAAGTAAAGCTTAGAGG + Intronic
971204274 4:24548185-24548207 CAGGCTGGAGTGCAGTGTTGCGG + Intronic
971403291 4:26296092-26296114 CTGTCTTAAGTGGAGTTTAGAGG + Intronic
971999983 4:34019291-34019313 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
973829571 4:54745076-54745098 CAGGCATAAGGGAAATTTTGCGG - Intergenic
974044138 4:56883471-56883493 CAGGCTGGAGTGCAGTGTTGTGG - Intergenic
976906496 4:90243106-90243128 CAGGCTGAAGTGTAGTGGTGTGG + Intronic
977221087 4:94338378-94338400 CAGGCTGGAGTGAAGTGTCGCGG - Intronic
977609770 4:99019929-99019951 AAGGCCTTAGTGAGGTTTTGGGG + Intronic
979061340 4:116066138-116066160 GAGGATTAAGTTAAATTTTGTGG - Intergenic
979190487 4:117850377-117850399 GAGGCTGTGGTGAAGTTTTGTGG - Intergenic
980078680 4:128321055-128321077 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
982248466 4:153379803-153379825 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
984160103 4:176241965-176241987 CAGGTGTATGTGCAGTTTTGTGG - Intronic
985428459 4:189854877-189854899 CCTGCTTAAGTGAGGTCTTGGGG + Intergenic
986091746 5:4514991-4515013 CTGGCTTAAGTGATGCTTTTGGG - Intergenic
988711767 5:33786177-33786199 CAGGCATGAGTGAACTTTTGGGG + Intronic
988733924 5:34002039-34002061 CAGGCTGAAGTGTAGTAGTGTGG + Intronic
989129071 5:38086535-38086557 GAGGCTGAATTGAAGTTTTAGGG + Intergenic
989239707 5:39189780-39189802 CAGGCTTCACCGAAGGTTTGAGG - Intronic
990571212 5:57080858-57080880 TATGCTTAGGTGTAGTTTTGTGG + Intergenic
990716165 5:58639584-58639606 CAGGCTTAGATGAAGTCATGAGG - Intronic
991557348 5:67910476-67910498 AAGGCTTAAGTGAATTTGTGTGG + Intergenic
992271715 5:75071215-75071237 AAGACTAAAATGAAGTTTTGAGG + Intronic
992311500 5:75505240-75505262 CAGGCTGGAGTGCAGTTCTGTGG - Intronic
995884512 5:116878636-116878658 CAGGCTTCAGTGAAGTGTGGTGG + Intergenic
996710215 5:126536075-126536097 CAGGCTGGAGTGCAGTGTTGTGG - Intergenic
996981795 5:129505147-129505169 CTGGCTTAAGGTATGTTTTGAGG - Intronic
998894325 5:146782491-146782513 CAGGCTGAAGTGAATTCATGTGG - Intronic
1000243798 5:159432415-159432437 CAGGCTGAAGTGCAGTTGTGTGG - Intergenic
1000298234 5:159931347-159931369 CAGGCTTGAGTGCAGTAGTGTGG - Intronic
1000617449 5:163443687-163443709 AAGGCTTCAGAGAAGTTTTTTGG - Exonic
1001047720 5:168387711-168387733 CAGGCTTAAATGAGGTCTTGAGG - Intronic
1002054407 5:176590398-176590420 CGGGCCTAAGTGGAGTTCTGTGG + Intronic
1004217156 6:13713131-13713153 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
1006676148 6:35765061-35765083 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
1006955726 6:37869551-37869573 CAGGCTTAAGTGCAGTGATGTGG + Intronic
1007672626 6:43568559-43568581 CAGGCTGGAGTGCAGTTGTGTGG - Intronic
1007862920 6:44932986-44933008 CAGGCTTAGGTGAAATATTGTGG - Intronic
1009815087 6:68722520-68722542 TAAGCGTCAGTGAAGTTTTGTGG - Intronic
1009889972 6:69668863-69668885 CAGGGTTGAGTGTAATTTTGAGG + Intergenic
1013086385 6:106861377-106861399 CAGGCTTCAGTGAAGCCTGGAGG - Intergenic
1013154869 6:107483856-107483878 CAGGCTTGAGTGCAGTGGTGCGG + Intergenic
1016057649 6:139595380-139595402 CAGGCTTCTGAGATGTTTTGTGG + Intergenic
1018124433 6:160668407-160668429 CAGGCCTGAGTTATGTTTTGTGG + Intergenic
1019021036 6:168917944-168917966 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1019806692 7:3131646-3131668 CAGGCTGAAGTGAATTTTGGGGG - Intergenic
1021699579 7:23304542-23304564 CAGGCTTCAGTGCAGTGGTGTGG + Intronic
1022769292 7:33451876-33451898 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1024056103 7:45660697-45660719 CAGGCTCAAGTGAGGTGTTCAGG + Intronic
1024660020 7:51484771-51484793 CAGGCTGGAGTGCAGTTTCGTGG + Intergenic
1025095043 7:56090158-56090180 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1026135330 7:67655694-67655716 CTGGTTTCAGTGAAGTTTAGAGG - Intergenic
1027812720 7:82925762-82925784 CAGGCTGAAGTGCAGTGGTGCGG + Intronic
1028019502 7:85752078-85752100 CATACTTAAGTGTGGTTTTGTGG - Intergenic
1028818419 7:95176677-95176699 CAGTGTTTTGTGAAGTTTTGGGG - Intronic
1028844525 7:95464679-95464701 CAGACTTGAGTGAAGGTTTCAGG - Intergenic
1029369416 7:100138791-100138813 TAGGCTGAAGTGAAGTGTAGTGG - Intergenic
1029825327 7:103186941-103186963 CAGCCTTAAGTGAATGTTGGCGG + Intergenic
1031343921 7:120641145-120641167 CTGGCTTAAGTGAAACTTTGAGG - Intronic
1031379183 7:121063790-121063812 TTGGTTGAAGTGAAGTTTTGTGG + Intronic
1031810185 7:126357869-126357891 CAGGATTAAGTGAAGAGTGGAGG - Intergenic
1032443948 7:131964059-131964081 GAGACTTAAGGAAAGTTTTGAGG + Intergenic
1032807438 7:135370803-135370825 GAGGAGTAAGTTAAGTTTTGGGG + Intronic
1036547529 8:9786313-9786335 CAGGCTTAAGTCAACTTGAGTGG - Intergenic
1037000982 8:13718408-13718430 CAGGCTGAAGTGCAGTGTTAGGG - Intergenic
1037270658 8:17126206-17126228 AAGGCTTAAGTGAAGGATTCAGG - Intergenic
1037421157 8:18704380-18704402 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1038636263 8:29289850-29289872 CAGGCTGGAGTGCAGTTATGCGG + Intergenic
1039038069 8:33381090-33381112 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1039421784 8:37449670-37449692 GAGGCTGAAGTTAAGTTTAGTGG + Intergenic
1040059416 8:43091917-43091939 CAGGCTAGAGTGAAGTTGTTGGG + Intergenic
1041628837 8:60062034-60062056 CAGGCCTAAGAGAAGGTTTGTGG - Intergenic
1041689621 8:60676490-60676512 CAGGCTAAAGGGGAGTGTTGGGG + Intergenic
1041745715 8:61207238-61207260 TGGGCTTAAGTGAAGTTCAGAGG + Intronic
1042000527 8:64118595-64118617 CAGGCTTAAGTGCAGTGCAGTGG - Intergenic
1043198514 8:77331206-77331228 AAGGCTTTAGTGAAAGTTTGGGG - Intergenic
1044113736 8:88308151-88308173 CAGGGTGAAGTGAAGAATTGTGG - Intronic
1044258435 8:90092543-90092565 TAGGCTTGACTGAAGTATTGGGG + Intronic
1044423860 8:92028799-92028821 CATGCTTATGTTCAGTTTTGGGG - Intronic
1048841467 8:138570276-138570298 CAGGCTGAAGTGAAGTAGCGTGG - Intergenic
1049853405 8:144846741-144846763 CAGGCTGAAGTGCAGTGGTGCGG + Intronic
1050346626 9:4695227-4695249 CAGGCTGAAGTGCAGTGGTGAGG + Intronic
1052100071 9:24435444-24435466 CAGGCTGGAGTGAAGTGGTGTGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054774856 9:69116659-69116681 CAGGCTGAAGTGGAGTTCAGTGG + Intergenic
1055498581 9:76881003-76881025 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1056043697 9:82695039-82695061 GAGGCTGTGGTGAAGTTTTGTGG + Intergenic
1056271184 9:84949510-84949532 CAGGCTGGAGTGCAGTTATGTGG + Intronic
1056580534 9:87885994-87886016 CAGGCTGGAGTGAAATGTTGGGG - Exonic
1057203432 9:93156211-93156233 GAGGCTGAAGTGACGTTCTGCGG - Intergenic
1058875355 9:109239307-109239329 CAGGCAGAAGAAAAGTTTTGTGG + Intronic
1059304233 9:113341273-113341295 CAGCCTTCAATGAAGATTTGTGG + Intergenic
1060206661 9:121686413-121686435 CAGGCTTAAGTGCAGGGCTGGGG - Intronic
1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG + Exonic
1060695149 9:125702976-125702998 CAGGCTAGAGTGCAGTTTCGTGG - Intronic
1061260558 9:129478608-129478630 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
1187319044 X:18223948-18223970 CAGGCTGGAGTGCAGTTTCGTGG - Intergenic
1187385324 X:18843269-18843291 CAGGCTTCAGTTCATTTTTGTGG + Intergenic
1188127333 X:26385157-26385179 CAGGCCAAAGTGAAGTTTTGTGG + Intergenic
1188818079 X:34739721-34739743 CAGGCCTAAGTGAGGTTCTGGGG - Intergenic
1192890600 X:75386518-75386540 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1194472738 X:94317342-94317364 CAGTCCTAAGTAAAGTGTTGAGG - Intergenic
1195351139 X:103997927-103997949 CTGGTTAAAGTGAAGTTATGAGG + Intergenic
1195356364 X:104043485-104043507 CTGGTTAAAGTGAAGTTATGAGG - Intergenic
1197236651 X:124073460-124073482 CAGGCTGGAGTGAAGTGGTGTGG + Intronic
1198455472 X:136813242-136813264 CAGGCTTGAGTGCAGTGGTGTGG + Intergenic
1198512857 X:137371670-137371692 CAGGAGAACGTGAAGTTTTGGGG + Intergenic
1198803967 X:140475387-140475409 CAGGCAAAAGTCAAGATTTGAGG + Intergenic
1200427387 Y:3036316-3036338 CTGGCTTGAATAAAGTTTTGAGG - Intergenic
1200773693 Y:7150876-7150898 CAGGCTAGAGTGCAGTGTTGGGG + Intergenic
1201777939 Y:17686919-17686941 CAGACTTAATTCAAGTTGTGAGG - Intergenic
1201823619 Y:18219073-18219095 CAGACTTAATTCAAGTTGTGAGG + Intergenic
1202350668 Y:23987023-23987045 CAGGCTTGAATGAAGCATTGTGG - Intergenic
1202520111 Y:25683098-25683120 CAGGCTTGAATGAAGCATTGTGG + Intergenic