ID: 1140610585

View in Genome Browser
Species Human (GRCh38)
Location 16:76593773-76593795
Sequence AGAGCTTCTCAGGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140610585 Original CRISPR AGAGCTTCTCAGGGTAAAGC AGG (reversed) Intronic
901940320 1:12656842-12656864 AAAGCTACTCAGTGTAAGGCTGG + Intronic
907321782 1:53607050-53607072 AGAGAGTCTGAGGGAAAAGCTGG - Intronic
909906555 1:81202667-81202689 AAAGCTTCTCAGCATGAAGCAGG - Intergenic
911745485 1:101437453-101437475 AGAGGTACTCAGGATAAAACTGG + Intergenic
912740961 1:112197071-112197093 TGAGATTCTCTGGGAAAAGCAGG + Intergenic
913066541 1:115261082-115261104 GAAGCTTCACAGGGTAGAGCAGG + Intergenic
913277733 1:117155545-117155567 AGAGCTTCCAATGGCAAAGCTGG - Intronic
913609134 1:120493395-120493417 AGGGCTTCACAGGTTCAAGCAGG - Intergenic
913986311 1:143569269-143569291 AGGGCTTCACAGGTTCAAGCAGG + Intergenic
914204694 1:145517054-145517076 AGGGCTTCACAGGTTCAAGCAGG + Intergenic
914483817 1:148090241-148090263 AGGGCTTCACAGGTTCAAGCAGG + Intergenic
914582058 1:149028444-149028466 AGGGCTTCACAGGTTCAAGCAGG + Intronic
916058340 1:161083024-161083046 ATACCTTCTTAGGGTACAGCAGG + Intronic
916127083 1:161581224-161581246 AGAGCTTCCCAGAATAAATCTGG - Intergenic
916137003 1:161663028-161663050 AGAGCTTCCCAGAATAAATCTGG - Intronic
916423514 1:164659292-164659314 AGATCTTCTGAGGGAAAAGGGGG + Intronic
918925701 1:190782704-190782726 AGAGCTTCTCCTGGTAAACAAGG + Intergenic
921264701 1:213412536-213412558 ACAGCTTCTGAAGGGAAAGCAGG - Intergenic
923235052 1:232024993-232025015 AGAGATTCTTAGAATAAAGCAGG - Intronic
1065774286 10:29104926-29104948 AGTGCTCCCCAGGGAAAAGCAGG - Intergenic
1065782245 10:29180778-29180800 AGATCTGCTCGGGGTAGAGCAGG + Intergenic
1067771657 10:49131030-49131052 GCAGCTTCTCAAGGTAGAGCAGG - Intergenic
1068392500 10:56416090-56416112 AGAGCTTTTAAGAGTAAAACTGG - Intergenic
1069079619 10:64074427-64074449 AGATATTTTCAGGGCAAAGCTGG - Intergenic
1070646087 10:78203405-78203427 AGAGCTGGTCAGGGTAGAGCAGG - Intergenic
1072499578 10:95999841-95999863 GGTGCTTCTCTGGGTGAAGCAGG + Intronic
1072540521 10:96394741-96394763 AGGGCTTCTCAGGATCATGCAGG - Intronic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1081758919 11:45563433-45563455 AGAGCTTGCCTGGGGAAAGCTGG - Intergenic
1081833486 11:46134714-46134736 AAAGCTTCTCTGGGAGAAGCAGG - Intergenic
1083459326 11:62800190-62800212 AGAACATCTCAGGACAAAGCTGG + Intronic
1084594357 11:70108133-70108155 TGAGCTTCTCAGGGAGAAACAGG - Intronic
1086449479 11:86901785-86901807 TGGGCTTCTCAGGATAACGCTGG - Intronic
1088215670 11:107505780-107505802 AGATAATCTCAGGGAAAAGCTGG - Intronic
1090860666 11:130649721-130649743 GGAGCTTCTAGGGGTAAAACTGG + Intergenic
1090963984 11:131582123-131582145 AGAACTCGTCTGGGTAAAGCTGG - Intronic
1093287369 12:17281261-17281283 AGAATTACTCAGTGTAAAGCGGG + Intergenic
1096388466 12:51211276-51211298 AGAGCTGCTCTGGTTAAAGCTGG + Intronic
1098875795 12:75865328-75865350 AGAGCTCCTCAAGGTACACCAGG + Intergenic
1102255492 12:111412377-111412399 AGATCTTCTCAGGGGAGAGGCGG - Intronic
1102522689 12:113488538-113488560 AGTGCTTCTCTGGGCAAAGCTGG + Intergenic
1108912131 13:55567625-55567647 AAAGCTTCTCATGTGAAAGCTGG + Intergenic
1112225254 13:97533377-97533399 GGAGAATGTCAGGGTAAAGCAGG - Intergenic
1114250563 14:20956597-20956619 TCAGCTTCTCAGCCTAAAGCAGG - Intergenic
1114848893 14:26359057-26359079 AGAGCCTATCAAGGCAAAGCTGG - Intergenic
1115058777 14:29165627-29165649 AGACCTTCTGTGGGTAAATCTGG + Intergenic
1118298180 14:64589730-64589752 ACAGCTACTCAGGCTAAAGCAGG - Intergenic
1120144890 14:80968796-80968818 CTAGCTTCTCATGGTAAAGAGGG + Intronic
1121457934 14:94050687-94050709 GGTGCTGCTCTGGGTAAAGCAGG + Exonic
1121482075 14:94286673-94286695 AGAGCTTCTCTGGCTAAAGACGG - Intronic
1122632942 14:103115849-103115871 AGAGCTTCTCATGATGAGGCAGG - Intergenic
1126426900 15:48537601-48537623 GGAGCTTGTCAAGGTAAACCCGG - Exonic
1128150320 15:65359411-65359433 AGCTCTTCTGAGGGTAAGGCTGG + Intronic
1129527036 15:76225113-76225135 AGAGCTTTTCAGGGGAGAGTAGG - Intronic
1135686189 16:24500099-24500121 AGAGCTTGTAGGGGTAAAGCTGG + Intergenic
1139338372 16:66249818-66249840 AAATCTTCTGAGGGCAAAGCCGG + Intergenic
1139342703 16:66278785-66278807 AGAGCTTCTCACAGTAAACAAGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1139847922 16:69933653-69933675 AGAGCTTCTAATGGTAAAGGGGG - Intronic
1140610585 16:76593773-76593795 AGAGCTTCTCAGGGTAAAGCAGG - Intronic
1141701029 16:85642141-85642163 AGAGCTTTTCAAGGTTGAGCTGG + Intronic
1142362373 16:89633465-89633487 GGAGCTCCTCAGGGGAAAGAAGG - Intronic
1144177828 17:12724137-12724159 AGAGCTTATCAGAGTAAACATGG - Intronic
1145279908 17:21459565-21459587 TGAGCTTCTTAGAGTAAAGGAGG - Intergenic
1145397974 17:22510917-22510939 CGAGCTTCTAAGGGTAAAGGAGG + Intergenic
1146211995 17:30950155-30950177 AGAGCATCACAGGGCAAAGAGGG - Intronic
1147415630 17:40287630-40287652 AGGGCGACTCTGGGTAAAGCGGG - Exonic
1149415016 17:56449908-56449930 AGAGATTCTCTGGGTGTAGCTGG - Intronic
1154941654 18:21119249-21119271 TGTGCTTCTCTGGGTAGAGCAGG + Intergenic
1156613185 18:38751660-38751682 ACAGCTTCTCAGGATGAAGCAGG + Intergenic
1157524497 18:48370393-48370415 ACAGGTTTCCAGGGTAAAGCAGG + Intronic
1157600097 18:48888444-48888466 AGAGCTTCTCAGGAGAAGGGGGG - Intergenic
1158572280 18:58606746-58606768 AGAACTGCTCAGGGTGAAGCTGG - Intronic
1158622091 18:59041515-59041537 AGAGCTGCTCAGGCTTCAGCAGG - Intergenic
1158634580 18:59145557-59145579 CGAGCTTCACAGGCTGAAGCGGG + Intronic
1159951381 18:74486718-74486740 AGAGCTTCTCACGGTGAACTGGG - Intergenic
1161009522 19:1953612-1953634 AGAGCTGACCAGGGAAAAGCTGG - Intronic
1163106618 19:15126752-15126774 AAAGCTTCTCAGCCGAAAGCTGG + Intergenic
1163325661 19:16601571-16601593 AGAGCTTCTAAGTGTGTAGCAGG + Intronic
1163389285 19:17020579-17020601 TGAGCTATTCAGGGCAAAGCTGG + Intronic
1163986908 19:20962070-20962092 AGAATGTCTCAGTGTAAAGCTGG + Intergenic
1167568117 19:50269768-50269790 TGTGCTTCTCAGGGATAAGCAGG + Intronic
927098425 2:19766355-19766377 AGTGGTTATCAGGGTAAAGCAGG - Intergenic
929386946 2:41420281-41420303 ATAGCTTCTCATGGTGAAGTAGG + Intergenic
931426530 2:62176950-62176972 ACAGCTTCACAGGGGAAAGCTGG - Intergenic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
933950737 2:87327016-87327038 ATTGCCTCTCAGTGTAAAGCAGG + Intergenic
934729626 2:96648420-96648442 AGAGCTTCACAGTGGAAAGAAGG + Intergenic
936125827 2:109788541-109788563 TCAGGTTCTCAGGGTAAAACAGG - Intergenic
936218866 2:110582927-110582949 TCAGGTTCTCAGGGTAAAACAGG + Intergenic
936329041 2:111531562-111531584 ATTGCCTCTCAGTGTAAAGCAGG - Intergenic
937092748 2:119217367-119217389 AGAGCCTCTCAGAGAAAAGGAGG + Intergenic
938342973 2:130547617-130547639 AGGGCTTCTCAGGGCCAGGCAGG - Intronic
938346860 2:130573105-130573127 AGGGCTTCTCAGGGCCAGGCAGG + Intronic
938595844 2:132786301-132786323 AGAGGTGCAGAGGGTAAAGCTGG + Intronic
942349053 2:175033788-175033810 TGTGCTTCTCTGGGTGAAGCAGG + Intergenic
944636825 2:201682635-201682657 AGAACTTCTCGGGGTAGAGGAGG + Intronic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
1173646758 20:44638120-44638142 TGACTTTCTCAGGGTCAAGCAGG - Intronic
1174123109 20:48282125-48282147 AAAGCATTTCAGTGTAAAGCAGG - Intergenic
1174672502 20:52321303-52321325 AGATTTCCTCAGTGTAAAGCAGG + Intergenic
1175909041 20:62395873-62395895 ACAGCCTCTCAGGGTGCAGCCGG + Intronic
1178639071 21:34331454-34331476 AGAGCTTCTGAGGATGAAGTGGG - Intergenic
1179059771 21:37968967-37968989 AGTCCTTCTCAGCATAAAGCTGG + Intronic
1179997291 21:44979981-44980003 AGAGCTTCTCAGAGTCCTGCAGG - Intergenic
1181308078 22:21928151-21928173 ACAGCTTCCCAGGTCAAAGCTGG + Intronic
1181935514 22:26435621-26435643 AGAGCTGCTGAGGGTGAAGAGGG - Intronic
949284051 3:2380578-2380600 AGATCTACTCAGTGTAAAGTGGG - Intronic
949911101 3:8908517-8908539 CGAGCTTCTCAGGGCCATGCAGG - Intronic
951475067 3:23096277-23096299 AGACATTCTCAGGGTATAGCTGG + Intergenic
951576563 3:24120596-24120618 AGAGCTTCTCAGGGTTACCCTGG + Exonic
951794635 3:26524522-26524544 AGAGCTTCTCTGGGTACTGGGGG - Intergenic
954621301 3:51997274-51997296 AGAGGTTGTCAGGGTCAAGTGGG - Intergenic
960038383 3:113124512-113124534 AAAGCTTCACTGGGTAATGCAGG + Intergenic
960581319 3:119281626-119281648 ACATCTTCTCATGGCAAAGCAGG - Intergenic
963414143 3:144973049-144973071 ACAGCTTCCCATGGCAAAGCAGG + Intergenic
963600883 3:147378086-147378108 AGAGCTTTGCAGGGTAATGGGGG - Intergenic
966140379 3:176750301-176750323 AGAGATTGTCAGGGTACAGTTGG - Intergenic
967922639 3:194624320-194624342 AGAGTTTCTCAGGAGAGAGCTGG - Intronic
969376693 4:6767998-6768020 AGAACTTCTCAGGGCTCAGCTGG + Intergenic
970990876 4:22211702-22211724 ACAGCATCTCAGGGCCAAGCTGG - Intergenic
972044029 4:34640283-34640305 AGAGCTTCTCCCGGTAAATAAGG + Intergenic
972817392 4:42658517-42658539 GGAACATCTCAGGGTAAAGCAGG + Intergenic
974775353 4:66473209-66473231 AGAGCTTCTCCCAGTAAAGAAGG - Intergenic
979962513 4:127037237-127037259 AGAGCTTCTCCTGGTAAACAAGG + Intergenic
981205354 4:142034112-142034134 AGAGAGTCTCATGCTAAAGCAGG - Intronic
983043356 4:162956410-162956432 AGAGCTTCAGATGGTAAACCTGG + Intergenic
983371834 4:166869930-166869952 GGAGCTTCTCAGTTTCAAGCTGG - Intronic
987653906 5:20781127-20781149 AGAGCTACTAAGTGTAAAACTGG - Intergenic
988406288 5:30827392-30827414 AGAGCTTCTCCCGGTAAACAAGG - Intergenic
989335597 5:40312941-40312963 AGAGCTTCTCTGGCTGAAGGAGG - Intergenic
989487425 5:42008390-42008412 AGAGCTCCTAAGGGTAAATTTGG + Intergenic
993475317 5:88357463-88357485 AGAGAGTCTCAGGATAGAGCTGG - Intergenic
994856461 5:105127260-105127282 ATAGCTTCTCAGGTTAAGGGTGG + Intergenic
998754184 5:145358157-145358179 AGTGCTTCTCAGGGGAACACAGG + Intergenic
1000442622 5:161281571-161281593 TGACCTTGTCAGGGTAAATCAGG + Intergenic
1001265003 5:170267906-170267928 TGAGCTTCTCAGGGTCACTCTGG + Intronic
1002371826 5:178760999-178761021 AAAGCTGCTCAGGGAAAACCAGG + Intergenic
1004117997 6:12790029-12790051 AGAGGTTATCAGAGTAAACCAGG - Intronic
1006374748 6:33665660-33665682 AGAGCATTTCAGGGGAAAGCCGG + Intronic
1010372504 6:75127364-75127386 AAAGCTCCTAAGGGAAAAGCAGG - Intronic
1012849075 6:104425180-104425202 ATAGCTTCTCAGTGAAAATCAGG + Intergenic
1013017978 6:106178446-106178468 GGAGCTTCTCTGGTTGAAGCGGG - Intergenic
1017674429 6:156798272-156798294 GGAGCTGCTCAGGGGAAGGCGGG + Intronic
1018152736 6:160955566-160955588 AGAGCTCCTCAGGGTGTGGCGGG - Intergenic
1019856048 7:3609369-3609391 AGAGCTAGTCAGGGGAGAGCTGG + Intronic
1020690223 7:11345771-11345793 AGATCTTCTCAAGGCAAGGCTGG - Intergenic
1021801831 7:24315040-24315062 AGAGCTCCTGAGGGTAAAGCTGG - Intergenic
1023026392 7:36054376-36054398 AGAGGTTCCCAGGCTAAAGATGG - Intergenic
1023515055 7:40993471-40993493 AGAGCTTCTCAGAGGGAAGATGG + Intergenic
1026248144 7:68641496-68641518 TGAGCTTCTCTGGGTGGAGCAGG - Intergenic
1026786418 7:73304401-73304423 AGATCTTCCTAGGGCAAAGCAGG + Exonic
1028053406 7:86212042-86212064 AGAGCTGCTCAGGATAAAACAGG - Intergenic
1029249742 7:99227202-99227224 GGAGCTCCTCTGGGCAAAGCTGG - Intergenic
1030758633 7:113321755-113321777 AAGGCTTCTCAGGGTAATGTGGG - Intergenic
1031789624 7:126084635-126084657 AGTGATCCTCAGTGTAAAGCAGG - Intergenic
1032547534 7:132756189-132756211 CGAACTTCCCAGGGTAATGCTGG - Intergenic
1032576627 7:133061272-133061294 AGAGACTGTCAGGGTAATGCAGG + Intronic
1033665380 7:143436148-143436170 AGAGGAGCTCAGGGCAAAGCTGG - Intergenic
1035671675 8:1422832-1422854 AGAGCTGCTCAGGGCAGAGTTGG + Intergenic
1036062776 8:5342703-5342725 AGAATGACTCAGGGTAAAGCCGG + Intergenic
1036593349 8:10189920-10189942 AGAGTTTCTCAGTGAAAATCTGG + Intronic
1038452194 8:27646926-27646948 AGTGCTTTGGAGGGTAAAGCGGG - Intronic
1039539148 8:38348519-38348541 AGATCGTCTCAGGTTAAAACTGG + Intronic
1041197322 8:55413045-55413067 AAAACTACTCAGGGTAAATCTGG - Intronic
1042227327 8:66524206-66524228 ACAGCTGCACAGGGTACAGCTGG - Intergenic
1045598366 8:103683864-103683886 TGAGATTATCAGGGAAAAGCAGG + Intronic
1045726959 8:105185653-105185675 AGAGCTTCTCCTGGTAAACCAGG - Intronic
1046093653 8:109533041-109533063 AGAGCTACTAATGGTAAAGCTGG + Intergenic
1046448402 8:114356508-114356530 AGAGCTTCTCTGGGCACAGAGGG + Intergenic
1047172192 8:122504482-122504504 AGAACTTCTCAGAGGAAACCAGG + Intergenic
1047794128 8:128236459-128236481 AGAGCATCACAGGTGAAAGCTGG + Intergenic
1049044276 8:140137069-140137091 AAAGCCTCTCAGGAAAAAGCGGG + Intronic
1051677898 9:19577067-19577089 AGAGAGTCTCAGGGCCAAGCAGG + Intronic
1053857597 9:42354718-42354740 ATAGCTTCTAAGTGTACAGCTGG - Intergenic
1055140183 9:72868033-72868055 AGACCTTCACATGGTAGAGCAGG - Intergenic
1056653021 9:88484919-88484941 TGCGCTTCTCTGGGTAGAGCAGG + Intergenic
1057357038 9:94340549-94340571 AGAGCTTCCCAGAATAAAGCCGG + Intergenic
1057650714 9:96917078-96917100 AGAGCTTCCCAGAATAAAGCCGG - Intronic
1057874306 9:98742364-98742386 AGAGCTCCTCAGGCCAAAGGTGG - Intronic
1058982767 9:110185495-110185517 AGAGCCTCTCAGGGTCATGCGGG + Intergenic
1059128512 9:111718924-111718946 AGAGCTTCTCTGGTTAAATTGGG - Intronic
1060233499 9:121842768-121842790 AGAGATTCTCCGGGGAAATCTGG - Intronic
1061812008 9:133167668-133167690 AGAGCTGCTCAGGGTGGAGCTGG - Intergenic
1062043236 9:134413725-134413747 ACAGCCCCTCAGGGTCAAGCAGG - Intronic
1187145088 X:16630052-16630074 AGAGCTCCTCAGGTTGATGCCGG - Intronic
1188743080 X:33809885-33809907 AGAGCATCTCAGGGTACTGGGGG - Intergenic
1189379494 X:40491718-40491740 GCTGCTTCTCAGGGTAAGGCGGG - Intergenic
1189537131 X:41947061-41947083 AGAGCTTCTAAAGGAAATGCTGG + Intergenic
1189589618 X:42497188-42497210 GGAACTTCTGAGAGTAAAGCAGG - Intergenic
1190386535 X:49887073-49887095 AGAGCTTCTCTGGTTGAAGTGGG - Intergenic
1192026293 X:67456543-67456565 AGAACTTGGCAGGGTTAAGCAGG - Intergenic
1192198569 X:69048683-69048705 AGAGCTACTCAAGGTGAAGCAGG - Intergenic
1193192870 X:78593286-78593308 AGAGCTTCTCTGGGTGATGAGGG - Intergenic
1193592737 X:83409693-83409715 AGATCTGCTCAGTGCAAAGCTGG - Intergenic
1195707632 X:107749644-107749666 AGAGCTACTCAGGGTGAAGTTGG + Intronic
1196527997 X:116750122-116750144 AGAGCTTCTCCCGGTAAACAAGG - Intergenic
1199635408 X:149807956-149807978 AGGGCACCTCAGGGTACAGCCGG - Intergenic
1199875287 X:151923413-151923435 AGAGCACCTCAGGGTATAGCCGG - Intronic
1199952509 X:152716856-152716878 AGGGCACCTCAGGGTACAGCCGG - Intronic
1199955132 X:152736047-152736069 AGGGCGCCTCAGGGTACAGCCGG - Intronic
1199957174 X:152751592-152751614 AGGGCACCTCAGGGTACAGCCGG + Intronic