ID: 1140611127

View in Genome Browser
Species Human (GRCh38)
Location 16:76600359-76600381
Sequence AATGATTCCCCCATTTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140611127_1140611128 2 Left 1140611127 16:76600359-76600381 CCTATTTAAATGGGGGAATCATT 0: 1
1: 0
2: 1
3: 10
4: 159
Right 1140611128 16:76600384-76600406 AACCACACAAGATGCTTAACAGG 0: 1
1: 0
2: 1
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140611127 Original CRISPR AATGATTCCCCCATTTAAAT AGG (reversed) Intronic
900960827 1:5918277-5918299 AAATATTCCCACATTTAAAAAGG - Intronic
909219941 1:72944960-72944982 AATTATTTTCACATTTAAATTGG + Intergenic
909558278 1:76980605-76980627 ATTCTTTCCCCCATTTAAAGAGG - Intronic
910420018 1:87050125-87050147 AATGTTTCTCTCATTTAAAGTGG + Intronic
910448687 1:87325735-87325757 TATGGTTCCCACATTTAATTAGG + Intergenic
910559682 1:88577034-88577056 AATGATTCCCCAGTTCAAAAGGG + Intergenic
910920630 1:92342710-92342732 AATGATTCCACCTTCAAAATAGG - Intronic
916337869 1:163693444-163693466 AAGCAGTCCCCCATTTCAATGGG - Intergenic
916812673 1:168319168-168319190 AATGAATTTCCCCTTTAAATAGG - Intergenic
919968821 1:202557546-202557568 AATGATTCCCCCACCTCAAATGG + Intronic
920748886 1:208655429-208655451 ATTGATTCTTCCATTAAAATAGG + Intergenic
920883732 1:209904369-209904391 TTTGATTCTCCCTTTTAAATAGG + Intergenic
921512442 1:216048894-216048916 GATGTTTCTCCCATTAAAATGGG + Intronic
921899848 1:220438680-220438702 AATGATGCTAACATTTAAATCGG + Intergenic
1065422447 10:25560671-25560693 AATGATCACACCAGTTAAATGGG + Intronic
1066148041 10:32583374-32583396 AATTTTTAACCCATTTAAATGGG - Intronic
1066268100 10:33796053-33796075 AATGATACCCCCATCTCTATAGG - Intergenic
1068372695 10:56138441-56138463 TATGATTTCCCCATTTTAAGTGG + Intergenic
1069471461 10:68694672-68694694 AATTATTCTCTCATTAAAATTGG - Intergenic
1070330791 10:75415523-75415545 ACTGATTCTCCCTTTGAAATGGG + Intergenic
1074056243 10:109924648-109924670 AATGATTTACAAATTTAAATAGG - Intergenic
1075642875 10:124077513-124077535 AAAGATTTTCCCATTTAAAGGGG - Intronic
1076113932 10:127882212-127882234 AATAAATCCCCCAATTTAATGGG - Intronic
1078434257 11:11311430-11311452 ATTCATTCCCCCATTCAAAATGG - Intronic
1081721593 11:45293676-45293698 TAGGATTCCCCCATTTTAAACGG + Intergenic
1085330027 11:75640547-75640569 AAATTTTCTCCCATTTAAATTGG - Intronic
1086500458 11:87447565-87447587 AAGGAGAACCCCATTTAAATTGG + Intergenic
1087594536 11:100236452-100236474 AATGTTTCCCCTTTTTACATTGG + Intronic
1087864505 11:103207414-103207436 AATGATTCCTCCATTCTCATAGG - Intronic
1088281457 11:108139221-108139243 AAATTTTCCCACATTTAAATAGG + Intronic
1089115618 11:116092771-116092793 AGTGATTCCCCCAGTTCTATAGG - Intergenic
1093424706 12:19015381-19015403 TCTGATTACCCCATTTAAGTAGG - Intergenic
1094126699 12:27031212-27031234 AAGGATACTCCCATTGAAATTGG - Intronic
1094259925 12:28482761-28482783 AATGATTCCACTTTTTGAATTGG + Intronic
1095761365 12:45840993-45841015 AAAGATTCCCCAATATAAATCGG - Intronic
1099838837 12:87940601-87940623 AATGATATCCCTAGTTAAATTGG + Intergenic
1100418807 12:94408490-94408512 AATGATCCCCATATTTAAAAAGG + Intronic
1101000728 12:100355151-100355173 AATAATTCACCCATTTCAAGTGG - Intergenic
1101830398 12:108252386-108252408 AATGATGCCCCCCTCTAAAATGG - Intergenic
1102424092 12:112827090-112827112 TATAATTCACCCATTTAAAGTGG + Intronic
1103981482 12:124739646-124739668 AGTGATGCCCCCATTGAAAAGGG - Intergenic
1105663928 13:22530967-22530989 AATAATTCCCACATTTTACTAGG - Intergenic
1106166238 13:27249131-27249153 AATGAATGCCCCATCTAAAGGGG + Intergenic
1109558745 13:64018801-64018823 AATGATTCCCCCATTTCATTCGG + Intergenic
1111002167 13:82198760-82198782 AATGATTTGGACATTTAAATGGG - Intergenic
1112702311 13:102024441-102024463 AATGCTTTTCCCATTTTAATTGG + Intronic
1113164191 13:107419211-107419233 AGTGATTCCTCAATTAAAATTGG + Intronic
1116107141 14:40523726-40523748 AATGAGTACCCAATTTAATTGGG - Intergenic
1116273738 14:42804920-42804942 AATGTTTCCCCTTTTTACATTGG - Intergenic
1117853292 14:59999147-59999169 AATGAAGACTCCATTTAAATGGG - Exonic
1119038491 14:71250953-71250975 AATGATTACCCATTTTAAATAGG - Intergenic
1120103057 14:80466338-80466360 AATGTTTCCCCTTTTTACATTGG - Intergenic
1120592640 14:86393961-86393983 AATTGTTCCACCATTTAAGTTGG + Intergenic
1120598300 14:86468630-86468652 TATGATTCACCCATTTAAACTGG + Intergenic
1126542735 15:49840503-49840525 AATGTTTCCCCTTTTTACATTGG - Intergenic
1128946140 15:71822884-71822906 AATGACTCCCACATTTGATTGGG - Exonic
1130294370 15:82633850-82633872 AATGATTCCCACTTTTAAGGAGG - Intronic
1133494796 16:6306860-6306882 CATGTTTCCACCACTTAAATGGG - Intronic
1136661356 16:31765949-31765971 AATGTTTCCCCTTTTTACATTGG + Intronic
1138948514 16:61881937-61881959 AAGCATTTCCCCCTTTAAATTGG + Intronic
1140611127 16:76600359-76600381 AATGATTCCCCCATTTAAATAGG - Intronic
1143149875 17:4801284-4801306 AATGACTCCACCATTTGAAGGGG - Intergenic
1143596319 17:7916307-7916329 ACTTATTCCCCTATTTAAAGGGG - Intergenic
1144329529 17:14211790-14211812 AATGGTTCCCTCATTTACAGTGG - Intergenic
1158645125 18:59239161-59239183 AATGCGTCCCCCATTTATAGGGG - Intergenic
1159498112 18:69232205-69232227 AAAGATTCTTCCATTTAGATTGG + Intergenic
1168164579 19:54537913-54537935 ATTGATTGCCCCATTAAAGTAGG - Intronic
925612237 2:5711338-5711360 GATGAAACCCACATTTAAATAGG - Intergenic
932641756 2:73454916-73454938 ATTGATTACCCGATTTAAAGTGG + Intronic
932940011 2:76152958-76152980 AATCATTCACTCATTTAAATAGG + Intergenic
933273479 2:80258952-80258974 AAGGAGGCCCCCATTTAAAAAGG + Intronic
934014151 2:87860512-87860534 AATCATTCCCTCATTCAAAAGGG + Intergenic
939849337 2:147285495-147285517 CATGATTCTCCCATTTCAATAGG + Intergenic
941903710 2:170701486-170701508 AATGGTTCCCCCATTGAATATGG - Intergenic
942304860 2:174597313-174597335 ATTTATTTTCCCATTTAAATTGG - Intronic
943700002 2:190979435-190979457 AATGATTTACCCAGTTAAAAGGG + Intronic
944916524 2:204366189-204366211 AATTATTACCCCATGGAAATGGG - Intergenic
945338725 2:208624253-208624275 AATGATAACACCATTTAAAGTGG - Intronic
1169516664 20:6323564-6323586 AGTGATTCCCCTACTTAAAATGG - Intergenic
1176971192 21:15267777-15267799 AATCATTCTCACCTTTAAATTGG + Intergenic
1177222934 21:18217811-18217833 AATATTTCCCCATTTTAAATGGG - Intronic
1177414323 21:20774972-20774994 AGTGATTCCCTGATTTAGATGGG + Intergenic
1177705370 21:24697306-24697328 AATGATTCTCCAACTTGAATTGG + Intergenic
1181798825 22:25330613-25330635 AACAATTCACCCATTTAAAGTGG + Intergenic
1184825390 22:46947171-46947193 AATGTTTTCCCCATTCAAACTGG - Intronic
949183151 3:1159094-1159116 GGTGATTTCCCCCTTTAAATTGG - Intronic
949662545 3:6295829-6295851 AATGATTACACAAATTAAATAGG + Intergenic
951148479 3:19258030-19258052 ACTGATACCCTCATTTAAAAGGG - Intronic
953835628 3:46340606-46340628 TAAGATTCACCCATTTAAAATGG - Intergenic
954069090 3:48129886-48129908 AATGACTTTCCCATCTAAATTGG - Intergenic
954786921 3:53100343-53100365 ATTGATTCCCCCCTTTTAAGAGG + Intronic
955106471 3:55903630-55903652 AATGAATACCCCATTTTGATGGG + Intronic
957938999 3:86980865-86980887 AATGATGCCACCATGTAGATAGG - Intronic
958528853 3:95297810-95297832 AAAGATTACCACATTTCAATAGG + Intergenic
962128409 3:132647186-132647208 AATGATCCTCCCATGCAAATGGG - Intronic
962562647 3:136623432-136623454 AATGAATCCCCCAAATAAAGAGG + Intronic
964549689 3:157872962-157872984 CATGCTTTCCCCATTTAAAATGG - Intergenic
964577233 3:158185845-158185867 AATAATTCCTCCAATTACATTGG - Intronic
965093281 3:164189373-164189395 AATAATTCCTGCAATTAAATGGG - Intergenic
965765106 3:172122405-172122427 ATTTGTTCCCTCATTTAAATTGG + Intronic
966056271 3:175694337-175694359 AATAATTTCCCTATTTAAAAAGG - Intronic
970174971 4:13330455-13330477 AATGAGTCTGGCATTTAAATTGG + Intergenic
971731609 4:30390272-30390294 AATGGTTCTACAATTTAAATAGG - Intergenic
972120704 4:35698185-35698207 AATGCGTCCTCAATTTAAATAGG + Intergenic
972274624 4:37545531-37545553 AAGGATTCTACCATCTAAATTGG + Intronic
973956212 4:56065906-56065928 CCTGATTCCCTCATGTAAATGGG + Intergenic
978574023 4:110170621-110170643 CATGATTTCCCTATTTAAATTGG + Intronic
980765518 4:137298980-137299002 AATATTTCCCGTATTTAAATAGG + Intergenic
982948118 4:161652454-161652476 AAAAATTCACCCATGTAAATGGG + Intronic
983115862 4:163815192-163815214 AATGACTTTTCCATTTAAATTGG + Intronic
984006423 4:174315212-174315234 AATTAGACACCCATTTAAATTGG - Intronic
985180886 4:187260857-187260879 AATGATTCCAAAATTTACATGGG + Intergenic
989539284 5:42599848-42599870 AATGTTTGCCCCATCTAAAAGGG - Intronic
991499332 5:67261016-67261038 TATTATTTCCCCATTCAAATTGG + Intergenic
995700247 5:114927931-114927953 AAAGATGACACCATTTAAATTGG + Intergenic
996947906 5:129092976-129092998 AATGATTGCACCATTAAACTAGG + Intergenic
999344244 5:150801169-150801191 AATGATTTTCTCATTTAATTCGG - Intergenic
1003787944 6:9507973-9507995 GTTGCTTCCCCCATTTTAATAGG + Intergenic
1008068284 6:47073816-47073838 AATGACACCACCATTTAAATCGG - Intergenic
1009678716 6:66862581-66862603 AATGATGCCTCCATGAAAATTGG + Intergenic
1010274470 6:73953148-73953170 ACTGATTCTCCCATGTATATAGG - Intergenic
1010400032 6:75437872-75437894 AATGATTTCCCAACTTAGATTGG - Intronic
1012502415 6:99903607-99903629 AAGGAATCAGCCATTTAAATTGG + Intergenic
1012587997 6:100946785-100946807 AATGTTTCCCCTTTTTACATTGG - Intergenic
1016257008 6:142119317-142119339 CAGGATACCCCCATCTAAATAGG + Intergenic
1017178609 6:151528248-151528270 AATTTTTCCCCTATTTAAAATGG - Intronic
1017515344 6:155151443-155151465 AATCATTGCCCCTTTTAAAAAGG + Intronic
1018157381 6:160998756-160998778 AATGCTTTCCCCATTTTAAGCGG + Intronic
1021754637 7:23840029-23840051 AATCTTTCCCACATGTAAATGGG - Intergenic
1023465460 7:40449603-40449625 AATGATTCCCCCATTTTGTTTGG - Intronic
1024097275 7:45992470-45992492 TATAGTTCACCCATTTAAATTGG + Intergenic
1026636487 7:72087186-72087208 AATGTTTCACCCACTGAAATAGG + Intronic
1027939683 7:84659714-84659736 GAATATTCCCCCATTTAAAATGG + Intergenic
1028414183 7:90562315-90562337 TATAATTCACCCATTTAAAGTGG - Intronic
1029072087 7:97907862-97907884 AATTATTGCCCAATTAAAATAGG + Intergenic
1031873705 7:127114302-127114324 CATGATTTCCCCATTTCAATAGG - Intronic
1032707860 7:134437446-134437468 AGTAATTCTGCCATTTAAATCGG + Intergenic
1033032210 7:137837978-137838000 AAAGTTTCTCCCTTTTAAATTGG - Intronic
1034878662 7:154747357-154747379 AATGATTTGCCCAGTGAAATGGG + Intronic
1035948534 8:3992813-3992835 AACAATTCGCCCATTTTAATTGG + Intronic
1037850971 8:22327775-22327797 AATCCTTTGCCCATTTAAATTGG + Intronic
1039360687 8:36873544-36873566 AAAGATTTTCCCAATTAAATGGG - Intronic
1039657984 8:39431112-39431134 AAAAATAACCCCATTTAAATTGG - Intergenic
1040996065 8:53403941-53403963 AAGGATTCTGACATTTAAATTGG - Intergenic
1041850569 8:62387173-62387195 GATGATTCCCTGATTTTAATGGG - Intronic
1043155778 8:76777209-76777231 AACTTTTCCCCCATTTTAATTGG - Intronic
1043989891 8:86739867-86739889 AATGATTCTTGCATTTAAAATGG + Intronic
1045301524 8:100914928-100914950 AATAATTATCCCACTTAAATGGG + Intergenic
1045608223 8:103802926-103802948 AAGGATTCAGGCATTTAAATTGG + Intronic
1046238020 8:111452488-111452510 AATGAATCCACAATTTAAGTAGG - Intergenic
1048535910 8:135294321-135294343 AATGGTTACCTCATTTAATTAGG - Intergenic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1052110994 9:24581027-24581049 AATAAATCCTCCATTTAATTTGG - Intergenic
1055327666 9:75148829-75148851 AGTGATTGCACCCTTTAAATAGG + Intergenic
1055329061 9:75162960-75162982 AATGTTTTGCCCATTTAAATTGG + Intergenic
1056235175 9:84587132-84587154 AATGATTGCACCTTTTAAACAGG + Intergenic
1056996531 9:91466984-91467006 AATGATTCCCCCAATGAAGAGGG + Intergenic
1058909719 9:109509721-109509743 AATTATTCCCTCATGTGAATTGG - Intergenic
1059722413 9:116974172-116974194 AATGCTTCCCCTAATCAAATTGG + Intronic
1060256780 9:122037995-122038017 ATTGATTCTCCCTTTAAAATAGG + Intronic
1188085200 X:25895029-25895051 AATGTTTCCCCTTTTTACATTGG - Intergenic
1189012857 X:37063884-37063906 AATGCTTACCACATTTCAATGGG + Intergenic
1193550368 X:82884890-82884912 AATAATAACCCCATTAAAATGGG + Intergenic
1193641873 X:84019184-84019206 AATAATTCACCTATTTAAAAAGG + Intergenic
1194761912 X:97804880-97804902 AATTATCCCCTCATTAAAATGGG - Intergenic
1195356184 X:104041914-104041936 GATTATTCCACCATTTAAAGAGG + Exonic
1196070646 X:111517573-111517595 AAGCATTCCACCATGTAAATAGG + Intergenic
1198305485 X:135378729-135378751 AATCAGTGCCCCTTTTAAATTGG + Intergenic
1199130321 X:144177960-144177982 AATCATTCCCTCATTCAAAAGGG - Intergenic
1202304629 Y:23455502-23455524 AATGATTCCCCCACCTCAAATGG + Intergenic
1202566181 Y:26215089-26215111 AATGATTCCCCCACCTCAAATGG - Intergenic