ID: 1140612243

View in Genome Browser
Species Human (GRCh38)
Location 16:76614287-76614309
Sequence CAGAGTTTCCAGATGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140612241_1140612243 2 Left 1140612241 16:76614262-76614284 CCAGCAATTTTATATTTGTCTCT 0: 1
1: 1
2: 2
3: 33
4: 509
Right 1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG 0: 1
1: 0
2: 2
3: 14
4: 175
1140612239_1140612243 10 Left 1140612239 16:76614254-76614276 CCCTACTGCCAGCAATTTTATAT 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG 0: 1
1: 0
2: 2
3: 14
4: 175
1140612238_1140612243 17 Left 1140612238 16:76614247-76614269 CCAAAATCCCTACTGCCAGCAAT 0: 1
1: 0
2: 1
3: 9
4: 193
Right 1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG 0: 1
1: 0
2: 2
3: 14
4: 175
1140612240_1140612243 9 Left 1140612240 16:76614255-76614277 CCTACTGCCAGCAATTTTATATT 0: 1
1: 0
2: 1
3: 21
4: 261
Right 1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG 0: 1
1: 0
2: 2
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140612243 Original CRISPR CAGAGTTTCCAGATGGATGC TGG Intronic
900726685 1:4220945-4220967 CAAAGTGGCCACATGGATGCAGG + Intergenic
901094831 1:6669793-6669815 CAAAGTTATCAGATGGATGGGGG + Intronic
901316474 1:8313209-8313231 CAGAGTTTCAGGGTGGCTGCTGG + Intergenic
903376251 1:22868078-22868100 CAGAGCTCCCAAATGGATGTAGG - Intronic
904366526 1:30014366-30014388 CAGAGGCTCCAGATGGCTCCAGG + Intergenic
904603104 1:31684294-31684316 CAGAGTGTTCAGAGGGGTGCAGG - Intronic
905921962 1:41725622-41725644 TGGAGTTTCCATACGGATGCTGG - Intronic
907400560 1:54222447-54222469 CACAGCTTCCAGATAGCTGCAGG - Intronic
908110023 1:60887477-60887499 CAGAGTCTCCAGAAGGATTTTGG + Intronic
909530522 1:76676872-76676894 AACAGTTTCCAGATCCATGCTGG - Intergenic
909935301 1:81544076-81544098 CAGGGTTGCCAGATGGGTTCGGG - Intronic
913210904 1:116581646-116581668 CTGAGATTCCAGATGGGTGCAGG - Intronic
913490920 1:119379207-119379229 CAGAGTTTCATGTTGGAGGCTGG + Intronic
914679702 1:149930487-149930509 AAGAGTTCCCAGCTGGAGGCTGG + Exonic
917130653 1:171739127-171739149 GATAGATTCCAGATGGAGGCTGG + Intronic
920210190 1:204322374-204322396 GAGAACTTCCAGAAGGATGCCGG - Intronic
920242630 1:204564390-204564412 AAGAGTTTGCAGATGTAGGCAGG + Intergenic
924834689 1:247636587-247636609 CATAGCTTCTAGATGGGTGCTGG - Intergenic
1063017388 10:2092653-2092675 CCGATTTTCCAGATGCAGGCAGG - Intergenic
1065128409 10:22596422-22596444 CACAGATTCCAGATGTATTCAGG + Intronic
1065540572 10:26762364-26762386 AAGAGTTTCCCGATTGAAGCAGG + Intronic
1067935326 10:50606865-50606887 TATAGTTTGCTGATGGATGCAGG - Intronic
1068629149 10:59282122-59282144 CATTGTTTCCCTATGGATGCAGG - Intronic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1072856197 10:98949526-98949548 CAGAGTTTACAGATGGAATCAGG + Intronic
1073077100 10:100830959-100830981 GAAAGTTTCCAGGTGGAAGCTGG - Intergenic
1074040245 10:109781104-109781126 TAGAGATTCCAGATAGATGCTGG - Intergenic
1074132170 10:110589515-110589537 CAGTGGTTGCAGATGGATGGGGG - Intronic
1075511492 10:123076017-123076039 CAGAGTCACAAGATGGCTGCTGG + Intergenic
1077664179 11:4093327-4093349 CAGGGTTACCAGATAAATGCAGG + Intergenic
1078585843 11:12587940-12587962 CAGGGTTTCCCGATGGGAGCTGG - Intergenic
1078655050 11:13230960-13230982 CAGAGTTTCAATTTGGATGATGG - Intergenic
1081501729 11:43673212-43673234 CAGAGTTTCCTGATGAAATCAGG - Intronic
1081595317 11:44454755-44454777 CAGGGTTTCGAGAATGATGCAGG + Intergenic
1082281563 11:50276193-50276215 CAGACTTTTCAGATGGCTGATGG + Intergenic
1082311813 11:50659133-50659155 CAGATTTTCCAAATGGCTGAAGG - Intergenic
1083049172 11:59761700-59761722 CTCAGTTTCCAGATGGAGACTGG - Intronic
1083150523 11:60789119-60789141 CACATTTTCCACAGGGATGCAGG - Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1086194709 11:84123616-84123638 CAGAGTCTCCAGTGTGATGCTGG + Intronic
1088846994 11:113676759-113676781 AGAAGTTTCCAGATGGATGTGGG + Intergenic
1089326864 11:117663428-117663450 AAGAGCTCCCAGAGGGATGCTGG - Intronic
1090535602 11:127637991-127638013 CAGTGGTTCCAGACAGATGCTGG + Intergenic
1090580187 11:128151031-128151053 CTGAGCTCCCTGATGGATGCTGG - Intergenic
1092506802 12:9109983-9110005 CAGAGTTTCCAGTTAGAGGGTGG - Exonic
1093717368 12:22398969-22398991 GAGATTTTCCAGAGGGCTGCTGG - Intronic
1095315260 12:40753112-40753134 CAGAGTATTCACATGGTTGCAGG - Intronic
1096567288 12:52492511-52492533 CAGAGAGTGCAGATGGCTGCTGG - Intronic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1106185972 13:27410391-27410413 CAGACTTTCCAGCAGAATGCTGG + Intergenic
1109833433 13:67824372-67824394 CAGTGTCTCCATATAGATGCTGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113995375 14:16060537-16060559 CAGAGTTTCCAGACTGATCAAGG - Intergenic
1115157975 14:30361731-30361753 CAAAGATTCCACTTGGATGCTGG + Intergenic
1117468808 14:56021254-56021276 CATTGTTTCAAGATGGCTGCTGG + Intergenic
1118489265 14:66243489-66243511 CAGAATTTCCCTGTGGATGCAGG - Intergenic
1119439819 14:74620568-74620590 CAAACTTTCCAGATGGAGGGAGG - Intergenic
1119862319 14:77945141-77945163 CACAGTTCCCAGATGGATCCAGG - Intergenic
1122279557 14:100613283-100613305 CAAAGCTTCCAGATGGAGCCAGG - Intergenic
1124701202 15:31914106-31914128 CAGAGTTTCCTCATGCATTCTGG + Intergenic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1131558562 15:93419940-93419962 CAGAGCTGCCACATGGATCCTGG + Intergenic
1131649032 15:94378780-94378802 CAGCCTTTCCAGATGGGTCCTGG - Intronic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132390545 15:101435142-101435164 CAGAGTGTCCAGGTGGCTCCTGG - Intronic
1133295768 16:4751523-4751545 CAGAGTTTCCAAATGGAGCCCGG - Exonic
1135423936 16:22323018-22323040 CAGAGGCTCCAGGTGGAGGCGGG + Intronic
1139381902 16:66537777-66537799 GAAAGTTCCCAGATGGATCCTGG - Intronic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1141952967 16:87350925-87350947 CAGAGCTTCAAGATGCATGGAGG - Intronic
1145754179 17:27378825-27378847 CAGAGTTTACAGATGGGATCTGG + Intergenic
1147155339 17:38541982-38542004 CAGAGGCTCCAGGTGGAGGCTGG + Intronic
1151950903 17:77353226-77353248 CAGAGATTCCAGAAGGAGACTGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152261526 17:79269852-79269874 GAGAGTTTGCAGGTGGATGAGGG - Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1155719742 18:28996212-28996234 CAGAGTAGAAAGATGGATGCTGG + Intergenic
1157164136 18:45342585-45342607 CAGAGCAACCAGATGAATGCAGG + Intronic
1158262715 18:55626735-55626757 TTCATTTTCCAGATGGATGCTGG - Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1161417018 19:4153046-4153068 CAGAATTCCCAGATGGGTTCTGG - Intergenic
1162611792 19:11761088-11761110 CAGAGTTTCTAGGTGGTTGAAGG - Intergenic
1163194154 19:15702824-15702846 CTGATTAACCAGATGGATGCAGG - Intergenic
1166272719 19:41726692-41726714 CAGAGTTTCCACAAGGCTGGTGG + Intronic
928938996 2:36708315-36708337 AAATGTTTCCAGATGGATACTGG + Intronic
930021611 2:47005068-47005090 CAGAGTTGCCAGATGGCTGCTGG - Intronic
930348905 2:50223878-50223900 CAGAGTTTCCAGAGCAATGTGGG + Intronic
938536098 2:132250222-132250244 CAGAGTTTCCAGACTGATCAAGG + Intronic
940855798 2:158727813-158727835 CAGAGCTTCCAGATGGAGTCAGG - Intergenic
942388465 2:175466511-175466533 CAGAGGTTTCAGATGGATTTTGG + Intergenic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
943270226 2:185791753-185791775 CATAGTTTCCAGAAGGGTTCAGG + Exonic
943572777 2:189593608-189593630 CAGAGTTGCAAGATTGTTGCAGG + Intergenic
943578605 2:189658677-189658699 CATAGTTTCCAGTTGTATGGTGG + Intergenic
944142190 2:196468693-196468715 CAGATTTTCCACATGAATGAAGG + Intronic
945256822 2:207810144-207810166 CAGAATTTCAAGATGGAGACAGG + Intergenic
945485076 2:210385724-210385746 CTGAGCCTCCAGATGGATGCAGG - Intergenic
946045584 2:216818258-216818280 AAGATTTTTCAGGTGGATGCAGG + Intergenic
946227709 2:218273032-218273054 CAGTGTTCCCAGCTGGATGGTGG + Intronic
948027213 2:234787620-234787642 CAGAGCTTACAGAGGGTTGCAGG - Intergenic
948152374 2:235754647-235754669 TGGAGTTTCCAGATGGCTACTGG + Intronic
948842107 2:240656742-240656764 CAGAGACTGCAGATGGCTGCAGG + Intergenic
1168813279 20:720116-720138 CAGAGTCTCCAGCTGGAGGTTGG + Intergenic
1170762710 20:19264875-19264897 CTGAGCTTCCAGAGGGATCCTGG + Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172003173 20:31797557-31797579 CAGACTTCCCAGTGGGATGCTGG + Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1176130692 20:63495607-63495629 CAGAGTCCCCAGATAGATGGGGG - Intronic
1176997578 21:15574633-15574655 CAGATTTTGCAGATGGAAGTGGG - Intergenic
1177612165 21:23465926-23465948 CATAATGTCCAGAGGGATGCTGG + Intergenic
1179052244 21:37897694-37897716 GAGACTTCCCTGATGGATGCAGG - Intronic
1180311716 22:11246872-11246894 CAGAGTTTCCAGACTGATCAAGG + Intergenic
1180834666 22:18923857-18923879 CAGAGTGGCCAGCTGAATGCTGG - Intronic
1181065224 22:20302654-20302676 CAGAGTGGCCAGCTGAATGCTGG + Intergenic
1182265313 22:29110189-29110211 CAGAGCTCCCAGTTGAATGCAGG - Intronic
1182634812 22:31717532-31717554 CAGAGTTCACAGATCAATGCTGG + Intronic
1203284755 22_KI270734v1_random:149156-149178 CAGAGTGGCCAGCTGAATGCTGG - Intergenic
1203293553 22_KI270736v1_random:18827-18849 CAGAGTTGCCTAATTGATGCAGG + Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
952197516 3:31091781-31091803 TAGTGTTTCCAGATGCATCCAGG - Intergenic
953714042 3:45300838-45300860 GAGAGTTGCCAGCTGGCTGCTGG - Intergenic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
956567748 3:70658540-70658562 CACATTTTCCAGATGGAACCAGG + Intergenic
960403900 3:117236446-117236468 CAGAGTTTGCTGATGGGTGTTGG - Intergenic
960467675 3:118017297-118017319 TAGAATTTCTAGATGGAGGCTGG + Intergenic
960536977 3:118825549-118825571 CAGAGTTTCCCAAGTGATGCTGG - Intergenic
962082413 3:132154594-132154616 TAGAGTTTTCAGAAGCATGCTGG + Intronic
962123363 3:132587901-132587923 CAAAGTTTCCACATGAAAGCTGG + Intronic
962328827 3:134459624-134459646 CATAGTTCCAAGATGGCTGCTGG + Intergenic
966147304 3:176826502-176826524 TAGAGCTTCCAGATGGAGGGTGG - Intergenic
968620482 4:1601525-1601547 CAGACTTTCCAGGTGGGGGCTGG - Intergenic
969322286 4:6419748-6419770 CAGAGCTTCCAGAGGGAGCCAGG - Intronic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
978013920 4:103720563-103720585 CAGAGTCTCCAGCTGCCTGCTGG - Intergenic
979573545 4:122258744-122258766 CAGAGCTACCAGGTGGAGGCCGG - Exonic
980552401 4:134356294-134356316 CAGAACTTCCACATGGCTGCAGG - Intergenic
982098940 4:151949698-151949720 CAGAGCTTCCAGAAGGAACCAGG + Intergenic
996118339 5:119643726-119643748 CAAAGTTCCCAGATGGTTCCAGG - Intergenic
997817969 5:137036221-137036243 CAGAGTTACTAGATGGATAAGGG - Intronic
1001137200 5:169112480-169112502 CAGAGCCTCCAGATGGAAGAAGG - Intronic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1005344062 6:24871901-24871923 CAGGGGTTCCACATAGATGCAGG + Intronic
1008336383 6:50309563-50309585 CAGATTTTCCAGGTGGAAACTGG + Intergenic
1008644374 6:53498935-53498957 GACAGTTGCCAGATGGATGAGGG - Exonic
1009063462 6:58425932-58425954 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009251127 6:61300518-61300540 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1011390947 6:86852760-86852782 CACAGTTTCCAGATGGATCTAGG + Intergenic
1013848950 6:114490492-114490514 CAAAGTTTCCAGATGGACTGTGG + Intergenic
1019634150 7:2066667-2066689 CAGACTTCCCAGAAGGCTGCGGG + Intronic
1019727718 7:2612253-2612275 GCGAGCTTCAAGATGGATGCTGG - Exonic
1021045261 7:15915073-15915095 CAGAATTTACTGATGGGTGCTGG + Intergenic
1022345887 7:29514385-29514407 CATTGTTTCCAGATAGACGCTGG + Intergenic
1023272265 7:38476901-38476923 CAGAGCTTCCAGATGGTGGCGGG + Exonic
1023343842 7:39251132-39251154 GAGAGATTCCAGATGAATGTGGG - Intronic
1026349430 7:69502918-69502940 CAGAATTTCAGGATGGATTCTGG - Intergenic
1029168015 7:98609290-98609312 CATATTTTCCTGATGGAGGCTGG + Intergenic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1033158741 7:138979050-138979072 CTGTGTTTCCAGCTGGATCCTGG + Intronic
1033843159 7:145399710-145399732 GACAGTTTCCAGAAGGATTCTGG + Intergenic
1035610318 8:957995-958017 CAGAGTTTCTACAGGGATGACGG - Intergenic
1036999581 8:13702587-13702609 CAGAGTTTCTAGACGAATGCTGG + Intergenic
1037085556 8:14844906-14844928 CAGAGTTTTCAGATGCAGGGAGG + Intronic
1038032360 8:23653622-23653644 TTGAGTTTCCAGATGGAGGTGGG + Intergenic
1040567751 8:48582487-48582509 CAGTGTTTCCAGATGGCCGCTGG - Intergenic
1040875076 8:52142245-52142267 CAGAGAATCCAGGTGGAAGCTGG + Intronic
1041186864 8:55310002-55310024 TAGAGTTTCCAGATGAATGAAGG - Intronic
1042975483 8:74464569-74464591 CAGGGTGTCTAGATGGACGCAGG - Intronic
1045384901 8:101662675-101662697 AACAGTTTACAGATGGATTCGGG - Intronic
1046725643 8:117670718-117670740 CAGAGTATTGAGATGGTTGCAGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1048942794 8:139416743-139416765 CATGGTTTCAAGATGGCTGCTGG - Intergenic
1051118813 9:13729242-13729264 TAGATTTTCCAGGTGGATGTTGG - Intergenic
1051330640 9:16021977-16021999 CAGCCTCTCCTGATGGATGCAGG + Intronic
1053601769 9:39618175-39618197 AAGTTTGTCCAGATGGATGCTGG - Intergenic
1053859421 9:42371946-42371968 AAGTTTGTCCAGATGGATGCTGG - Intergenic
1054251766 9:62724271-62724293 AAGTTTGTCCAGATGGATGCTGG + Intergenic
1054565878 9:66758770-66758792 AAGTTTGTCCAGATGGATGCTGG + Intergenic
1055320781 9:75081595-75081617 CAGAGATGCCAGATGAAGGCTGG + Intronic
1055609648 9:78008479-78008501 CAGTTTTTCCAGTTGGATGGTGG - Intronic
1056795709 9:89657379-89657401 CAGTGTTTTCAGGTGGAAGCAGG - Intergenic
1059458535 9:114414947-114414969 CAGAGGTGCAAGGTGGATGCGGG - Intronic
1061139265 9:128754335-128754357 CAGAGTTCCCAGCTGGGTACAGG + Intronic
1061995445 9:134180687-134180709 CAGGGATTCCTCATGGATGCGGG - Intergenic
1194606451 X:95985024-95985046 CAAAATTTCCAGATGCATCCTGG - Intergenic
1194699500 X:97096498-97096520 CACAGTTGCCACATGGAAGCTGG - Intronic
1198747048 X:139901467-139901489 CAGAGATTGCTGATGGCTGCGGG + Intronic
1199531318 X:148850881-148850903 CAGATTCCCCAGATGGCTGCAGG + Intronic
1201945335 Y:19504463-19504485 CAGACTTTCCAGAGGGAATCGGG + Intergenic