ID: 1140613246

View in Genome Browser
Species Human (GRCh38)
Location 16:76626664-76626686
Sequence CAGATTGGTGAACCTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140613246_1140613248 -8 Left 1140613246 16:76626664-76626686 CCAATGGCAGGTTCACCAATCTG 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1140613248 16:76626679-76626701 CCAATCTGTCCCTGTGCCATTGG 0: 1
1: 0
2: 3
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140613246 Original CRISPR CAGATTGGTGAACCTGCCAT TGG (reversed) Intronic
900764068 1:4492275-4492297 CAAATTGGTGAACCTGGGAGTGG + Intergenic
901784508 1:11615949-11615971 GAGATTGATGAACTTGCCCTGGG + Intergenic
902669655 1:17964282-17964304 CACATTGGTGAAGGTGCCAATGG + Intergenic
903083231 1:20830285-20830307 CAGAATGGTGACCCTGCCTATGG - Intronic
905321063 1:37117709-37117731 CAGATAGCTGGATCTGCCATGGG - Intergenic
909148527 1:71970058-71970080 AGGTTTGGTGAACCTGCTATGGG - Intronic
912555054 1:110509885-110509907 CATTGTGGGGAACCTGCCATTGG - Intergenic
914711401 1:150216780-150216802 AAGATTTGAGAACCTGGCATGGG - Intergenic
916941534 1:169683495-169683517 CAGATCGGGGAACCTCCCTTGGG + Intronic
924532742 1:244907099-244907121 CAGATTGGTGCAGCTGCTGTGGG + Intergenic
1072655258 10:97325491-97325513 CAAATTGGTGACCCTGCCATTGG + Intergenic
1073394338 10:103205890-103205912 CAGATTGGGGGACCTCCCTTGGG + Intergenic
1076739183 10:132473454-132473476 CAGATTGGTGAACCGGAAAATGG + Intergenic
1077766709 11:5165666-5165688 CAGATTGGGGGACCTCCCTTGGG - Intronic
1080367906 11:31598403-31598425 GAGTCTGGTGTACCTGCCATTGG + Intronic
1086504258 11:87487236-87487258 AAGATTAGTGAACTTGACATAGG + Intergenic
1087228859 11:95636802-95636824 CAACTTAGGGAACCTGCCATTGG + Intergenic
1087839851 11:102909461-102909483 CAGATTGGGGGACCTCCCTTGGG - Intergenic
1089987088 11:122824848-122824870 CAGATTGGGGGACCTCCCTTGGG + Intergenic
1099069507 12:78027754-78027776 CACTGTGGGGAACCTGCCATTGG - Intronic
1101884133 12:108647259-108647281 CAGATTTGTCAACCAGCGATAGG - Exonic
1101988295 12:109464270-109464292 CAGGTTGGAGACCCTGCCCTAGG - Intronic
1102579688 12:113878483-113878505 CAGACAGCTGAACCTGGCATCGG + Intronic
1106665134 13:31844039-31844061 CATCGTGGGGAACCTGCCATTGG + Intergenic
1107628585 13:42317851-42317873 CAGACTGGTGAACCTGCCTCTGG - Intronic
1108947135 13:56040719-56040741 CAGATTGGGGGACCTCCCTTGGG + Intergenic
1110487687 13:76066128-76066150 CAGTTTGGTGTTCCTGCCATAGG + Intergenic
1114972576 14:28051718-28051740 CAGATTGGGTAACTTGCCACAGG - Intergenic
1119781477 14:77279077-77279099 GTGCTTGGTGCACCTGCCATTGG - Intronic
1121389837 14:93564534-93564556 CAGATTGGGGGACCTCCCTTGGG - Intronic
1121510426 14:94509169-94509191 CAGACTGGTGATCCAGCCCTAGG + Intronic
1123885158 15:24718965-24718987 CAGAATGGTGCAGCTGCCATGGG + Intergenic
1125244242 15:37616376-37616398 CATCGTGGGGAACCTGCCATTGG - Intergenic
1128148604 15:65347035-65347057 AAGATTGGTGACCCTGACACTGG - Intronic
1130051247 15:80485787-80485809 CAGAGTGGAGAACATGTCATAGG + Intronic
1132348560 15:101123018-101123040 CAGCTTGGTGGCCTTGCCATGGG - Intergenic
1132614179 16:832157-832179 CAAATGGATGAACCTGCCAATGG + Intergenic
1135661439 16:24300550-24300572 CAAATGGGTGATCCTGCCAGAGG - Intronic
1135851221 16:25965693-25965715 CAGATAGGTGAACATGACATGGG - Intronic
1136018423 16:27423414-27423436 AAGCTTGGTGAAGCTACCATGGG - Intronic
1140613246 16:76626664-76626686 CAGATTGGTGAACCTGCCATTGG - Intronic
1141584699 16:85025953-85025975 CAGATCAGTGAACCTGACATTGG - Intergenic
1142163607 16:88572548-88572570 CAGATGGGTGAACTTGCCTAAGG - Intronic
1146696928 17:34916254-34916276 CAGATTGGTGAGTGTGCCACAGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153264237 18:3253582-3253604 CAGATTCGTGACCCTGTCTTAGG + Intronic
1153701580 18:7699783-7699805 TATATTGGTGACCCTGGCATAGG - Intronic
1154960833 18:21307191-21307213 CAGATTTGGGTACTTGCCATTGG - Intronic
1155247612 18:23925009-23925031 GAGATTCCTGAAACTGCCATTGG + Intronic
1160699045 19:497500-497522 GTGATTGGTGATCCTGCCAGAGG + Intronic
1167901854 19:52628210-52628232 CAGATTGGGGGACCTCCCTTGGG + Intronic
929210427 2:39350908-39350930 CGGTTAGGTGAACCTGCGATTGG - Intronic
933163438 2:79051816-79051838 CAGATTGGGGGACCTCCCTTTGG + Intergenic
933713848 2:85345929-85345951 CACATTGGGGAACCTGCAAGAGG + Intronic
934543722 2:95197157-95197179 CAGACTGTTGAACATGCCAGAGG + Intergenic
936597150 2:113858968-113858990 CAGATTGGTGACTCTTCCACTGG + Intergenic
937897441 2:126989012-126989034 TACATTGGTGAATCTTCCATGGG + Intergenic
939907474 2:147934872-147934894 CAGATTGTTGAGCCTACCATAGG - Exonic
943846553 2:192656168-192656190 CAGATTAGGGAACCTGCCCAGGG - Intergenic
945590313 2:211720971-211720993 CACTTTGGAAAACCTGCCATTGG + Intronic
946432096 2:219631434-219631456 CAAGTTGGTGGCCCTGCCATGGG - Intronic
947388874 2:229620061-229620083 CAGATTGATGAAGCTAACATGGG + Intronic
948884214 2:240874880-240874902 CAGCTGTGTGACCCTGCCATGGG - Intronic
1170429820 20:16265650-16265672 CCCATTGGTGAAGATGCCATTGG + Intergenic
1170820989 20:19756308-19756330 CAGATTGGGGGACCTCCCTTGGG - Intergenic
1172817355 20:37698325-37698347 CAAAGTGGGGAACCTGCGATGGG - Intronic
1177100328 21:16892629-16892651 CAGATTGGGGGACCTCCCTTCGG + Intergenic
1178872769 21:36389978-36390000 GAGCTTGGTTAACATGCCATTGG - Intronic
1179387221 21:40955236-40955258 CAGATTGGGGGACCTCCCTTGGG + Intergenic
1180611075 22:17098384-17098406 CAGATTTGTGAACGGGGCATGGG + Intronic
1183004890 22:34892947-34892969 AAGATTGCTCTACCTGCCATGGG + Intergenic
1184709379 22:46239566-46239588 CAATTTGGTGAAACTGACATTGG + Exonic
1185122224 22:48978431-48978453 CAGAATTGTTAACCTGTCATTGG - Intergenic
950082041 3:10229581-10229603 CAAATGGGTGCATCTGCCATGGG - Intronic
950479043 3:13233492-13233514 CAGACTGTGGAACCTGCCACAGG - Intergenic
955110164 3:55941218-55941240 CAGTTGCGTGTACCTGCCATGGG + Intronic
955631187 3:60977287-60977309 CAGAATGCTGAACTTGCCACCGG - Intronic
956889597 3:73598893-73598915 CAGATTGCTGAAACTCCCACTGG - Intronic
958829557 3:99071219-99071241 CATTGTGGGGAACCTGCCATCGG + Intergenic
960023477 3:112982130-112982152 CAGATTGATGAAACTGGCATTGG - Intergenic
961078839 3:124006996-124007018 CAGAATGGTGCACCTGCAGTGGG + Intergenic
961893983 3:130152301-130152323 CAGATTGGGGGACCTCCCTTGGG - Intergenic
962933085 3:140055496-140055518 CAGGTTGGTTAACCTGTCCTTGG - Intronic
963185243 3:142408280-142408302 CATTGTGGGGAACCTGCCATTGG + Intronic
964516867 3:157520127-157520149 CAGAGAGGTGAACCTGGCTTTGG - Intronic
966066496 3:175827952-175827974 CAGATCGGGGAACCTCCCTTGGG + Intergenic
967644131 3:191900662-191900684 CAGATTGGGGGACCTCCCTTGGG - Intergenic
967956204 3:194879443-194879465 AACATTGGTGAACCTGCGAAAGG - Intergenic
972492399 4:39600203-39600225 CACATTGGAGAGCCTGGCATGGG - Intronic
972646851 4:40976644-40976666 CAGATTGATGACCCTCACATAGG - Intronic
975874263 4:78817547-78817569 CAGAGTGGTGTACCTAGCATGGG - Intronic
976944970 4:90753798-90753820 GAGATTGGAAAAGCTGCCATGGG - Intronic
977668631 4:99670348-99670370 CAGGTTGGTGAATCTGCCTTAGG + Intergenic
979972923 4:127159940-127159962 CAGATTTGGGAATCTGACATTGG + Intergenic
981921430 4:150088924-150088946 CATTGTGGAGAACCTGCCATTGG - Intronic
983452027 4:167923333-167923355 CAGATTGGGGGACCTCCCTTGGG + Intergenic
984099334 4:175466643-175466665 CAGATTGGGGGACCTCCCTTGGG - Intergenic
985057636 4:186049235-186049257 CAGATTGGGGGACCTCCCTTGGG - Intergenic
989615384 5:43332953-43332975 CAGATTGGGGTACCTCCCTTGGG - Intergenic
989689137 5:44119704-44119726 CAGATCGGGGGACCTGCCTTGGG - Intergenic
996215460 5:120860144-120860166 CAGATTTGTGATCCTGCAAAGGG - Intergenic
1000439407 5:161248837-161248859 CGGATTGGGGAACCTCCCTTGGG + Intergenic
1005054424 6:21716685-21716707 CCCATGGGTGAGCCTGCCATGGG + Intergenic
1008488410 6:52059814-52059836 CAGATAGTTTAACATGCCATTGG - Intronic
1011368167 6:86603454-86603476 CAGATTGGGGGACCTCCCTTGGG - Intergenic
1012003641 6:93685194-93685216 CAGGTTTGTGAACCTTCCCTGGG + Intergenic
1013937032 6:115609215-115609237 CAGAATGGTGAACCTGCATGTGG - Intergenic
1017411246 6:154169764-154169786 CAGAATGGTGGAACTGCCATTGG - Intronic
1020009601 7:4800775-4800797 CATAATGGTGATCCTGCCGTGGG + Intronic
1020315741 7:6904218-6904240 CAGATCGGGGGACCTGCCTTGGG + Intergenic
1022372589 7:29785407-29785429 CAGATTGGGGGACCTCCCTTGGG + Intergenic
1022534630 7:31088731-31088753 CATAATGGTGCATCTGCCATGGG - Intronic
1024490975 7:49985776-49985798 CAGATGTGGGAACCTGCCAAGGG + Intronic
1029050870 7:97685595-97685617 CATCATGGGGAACCTGCCATTGG - Intergenic
1032270556 7:130400792-130400814 CAGAATGATGATCTTGCCATGGG + Exonic
1032679904 7:134171703-134171725 CAGATGGCTGAACTTCCCATAGG + Intronic
1032709707 7:134451131-134451153 CAGATTGGCTAGCCTGCCCTAGG + Intronic
1033073949 7:138231187-138231209 CATCATGGGGAACCTGCCATTGG + Intergenic
1035558703 8:588703-588725 CTGATTGGTGTACCTGGGATGGG - Intergenic
1038272793 8:26089512-26089534 CAGATTGATTAACCAGCCAGAGG - Intergenic
1041313491 8:56539380-56539402 CAGAATGGGGAACCTGGCTTAGG - Intergenic
1043118396 8:76289288-76289310 CTGATTAGTGCATCTGCCATAGG - Intergenic
1043837398 8:85063256-85063278 CAGATTGGGGGACCTCCCTTGGG + Intergenic
1044605760 8:94045930-94045952 AAGTTTTGTGAACCTGCCCTGGG + Intergenic
1052833624 9:33234534-33234556 CAAATTGGTGAACCCAACATGGG + Intronic
1053057668 9:35003722-35003744 CAGATTGGAGGACCTCCCTTGGG + Intergenic
1056605773 9:88083627-88083649 CACATTGTTGAACCAACCATAGG + Intergenic
1057597738 9:96430678-96430700 CATTGTGGGGAACCTGCCATTGG + Intergenic
1195297275 X:103491277-103491299 CTGATTGGTGAACCTGGAACTGG + Intergenic
1200812505 Y:7500543-7500565 CAGATTTCTGAAACTGCCTTTGG - Intergenic
1202076852 Y:21044707-21044729 CAGATTGGGGGACCTCCCTTGGG - Intergenic