ID: 1140613298

View in Genome Browser
Species Human (GRCh38)
Location 16:76627513-76627535
Sequence CATTGTACACACATGTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140613295_1140613298 -10 Left 1140613295 16:76627500-76627522 CCAACCAATATTCCATTGTACAC 0: 1
1: 0
2: 2
3: 31
4: 245
Right 1140613298 16:76627513-76627535 CATTGTACACACATGTACAATGG 0: 1
1: 0
2: 3
3: 13
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140613298 Original CRISPR CATTGTACACACATGTACAA TGG Intronic
902511891 1:16971183-16971205 CATCATACACACAGGCACAAAGG - Intronic
902579699 1:17400666-17400688 CATTTTACACACCTATATAAGGG - Intronic
902798235 1:18813569-18813591 CAGTGTCCACAAGTGTACAATGG + Intergenic
902924738 1:19688708-19688730 CAGTTTTCACACCTGTACAACGG + Intronic
903278871 1:22238815-22238837 CAGTTTACACATCTGTACAATGG - Intergenic
908079053 1:60555277-60555299 CATTTTACACAAATGTTCATAGG + Intergenic
910864185 1:91772741-91772763 CATTGTACACCATTCTACAATGG - Intronic
911774075 1:101786027-101786049 CATTGAGAACACATGGACAAAGG + Intergenic
916700090 1:167283257-167283279 CATTTTACAAAAATGTAAAAAGG - Intronic
916913625 1:169382036-169382058 CATAGAACACACATGAACACCGG - Intronic
918505560 1:185250093-185250115 CATTGTCCATACAGGTTCAAAGG - Intronic
918754181 1:188316132-188316154 CACTGTAAACACATGTCCTAAGG + Intergenic
918875641 1:190038945-190038967 ACTTGTATACAAATGTACAAGGG + Intergenic
918930588 1:190851351-190851373 TATTCTGCACACATGTATAATGG + Intergenic
921210277 1:212890179-212890201 TATTGTACACCCATGTGCATGGG - Intronic
922494641 1:226047060-226047082 CCTTGCACACACATGTGCAAGGG - Intergenic
1062827139 10:580593-580615 CATTGTAAATACATGTACAATGG + Intronic
1063356578 10:5405252-5405274 CATAGGACACAGATGTAAAAAGG - Intergenic
1063496570 10:6514769-6514791 CATTTTTCCCACATATACAAAGG - Intronic
1063820895 10:9833977-9833999 CACTATACACACAGGTAAAAAGG - Intergenic
1064814745 10:19246989-19247011 CATTATACACATTTGTATAATGG - Intronic
1065085028 10:22165399-22165421 GACTTTACAGACATGTACAAAGG - Intergenic
1068204221 10:53827990-53828012 GGCTGTACACACATGTACAAGGG + Intronic
1068869081 10:61924540-61924562 TATTATCCTCACATGTACAAAGG - Intronic
1069338460 10:67381934-67381956 CATTTTACTTACATGTACATTGG + Intronic
1070958833 10:80484597-80484619 CGTTGTACACAAATGAACAAAGG - Intronic
1070981427 10:80651754-80651776 TATTGTACTCAAAAGTACAATGG + Intergenic
1071392916 10:85193576-85193598 CATTGCACACTCATAGACAAAGG - Intergenic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1074850094 10:117432604-117432626 CATTGTACACACATTGTCAGGGG + Intergenic
1081079689 11:38726265-38726287 CAATGTGAACACATGTACACAGG - Intergenic
1085256565 11:75176940-75176962 CTTTGTACAGACAGGTGCAAGGG - Intronic
1086689902 11:89777604-89777626 CATTGTTCAAACATATAGAATGG + Intergenic
1086698765 11:89875370-89875392 CATTGTTCAAACGTGTAGAATGG - Intronic
1086707405 11:89969129-89969151 CATTGTTCAAACGTGTAGAATGG + Intronic
1086715954 11:90062351-90062373 CATTGTTCAAACATATAGAATGG - Intergenic
1087018177 11:93574917-93574939 CAATGTAAACACATGGACACAGG + Intergenic
1088842603 11:113639446-113639468 CATTGTAAACACGTCTGCAAAGG + Intergenic
1088860909 11:113798710-113798732 TATTCTACCCACATGTAAAAGGG + Exonic
1089134244 11:116236505-116236527 CATTGTCTACACCTGAACAAAGG + Intergenic
1089247684 11:117134313-117134335 CATTGCAAAGAAATGTACAAGGG + Intergenic
1091215096 11:133896260-133896282 CATTGAACACACATGTACTGAGG - Intergenic
1091523196 12:1268953-1268975 GACTGTGCACACCTGTACAAAGG - Intronic
1097604378 12:61734311-61734333 CATTGAAAACACATGGACATGGG + Intronic
1098877826 12:75884929-75884951 CATTATACACACAAGAAGAAAGG + Intergenic
1103910382 12:124348976-124348998 CCATGTACACACATGTACCAGGG + Intronic
1104312815 12:127669860-127669882 CAGTATACACACATACACAATGG - Intergenic
1104425734 12:128676700-128676722 AATTCAACACACATGTATAAGGG + Intronic
1108256217 13:48613491-48613513 CATTGTAAACATTTGTATAAAGG + Intergenic
1109294939 13:60518597-60518619 CTTTGTAAATACATGTAAAAAGG + Intronic
1109677090 13:65691504-65691526 AATAGTACACACATTTAAAAGGG - Intergenic
1109706908 13:66106815-66106837 CATAGTACATACATGTGCACTGG - Intergenic
1110259121 13:73465382-73465404 CATTGTACACACAAGTATATAGG - Intergenic
1110597151 13:77331733-77331755 CGTGGTACACACATACACAATGG - Intergenic
1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG + Intergenic
1112135310 13:96571916-96571938 CATGGTACACGTATGTGCAATGG - Intronic
1113264372 13:108601155-108601177 CATGGGACACACATCTGCAAAGG - Intronic
1115146913 14:30236948-30236970 CATGGTCCTCACATGGACAATGG - Intergenic
1115305154 14:31926120-31926142 AATTCTACAAACAAGTACAAAGG - Intergenic
1118078889 14:62335336-62335358 CATTCTACACACATATATATAGG + Intergenic
1118281635 14:64434148-64434170 CATTACTCACACATGTACAAAGG - Intronic
1119126300 14:72130303-72130325 CATTGTTCACTCTTGAACAATGG - Intronic
1119756178 14:77121346-77121368 CAATGTACTCACTTGTGCAAGGG - Intronic
1121510616 14:94510147-94510169 CAGTGTACTCACCTGTACAATGG + Intronic
1202924681 14_KI270724v1_random:13291-13313 CAATGTGAACACATGTACACCGG + Intergenic
1123722573 15:23072541-23072563 CATTGTACACACAAGGAGACAGG + Intergenic
1126418946 15:48450822-48450844 CATTTTAAACAGATGCACAAAGG + Intronic
1127837552 15:62802388-62802410 GAATGGACACACATATACAATGG + Intronic
1128918529 15:71589718-71589740 CTCTGTGCACACATGTACAAGGG - Intronic
1129774364 15:78225696-78225718 CATTTTACATAGAAGTACAAAGG + Intronic
1138539258 16:57678700-57678722 CCTGGTATACACATGTGCAAGGG - Intronic
1139197890 16:64942574-64942596 CATTTTCCACAAGTGTACAATGG - Intergenic
1140613297 16:76627512-76627534 CATTGTACATGTGTGTACAATGG - Intronic
1140613298 16:76627513-76627535 CATTGTACACACATGTACAATGG + Intronic
1143561479 17:7698230-7698252 CATTCTGTACACATGTAGAAGGG - Intronic
1145269687 17:21398126-21398148 TCTTGTACACATATGTACACAGG - Intronic
1146500178 17:33357234-33357256 CATTGTTCACATATGCACAGGGG + Intronic
1148037148 17:44673461-44673483 CATTGTACAGTCACGTAGAAAGG + Exonic
1152234417 17:79131039-79131061 CACGGTACACACAAGTACATGGG - Intronic
1155255718 18:23996614-23996636 CATTTTTCACACATGTGCACAGG - Intronic
1157224164 18:45847698-45847720 CATTTTTCATACTTGTACAAAGG - Exonic
1158269821 18:55700715-55700737 CCTTGTACACAAATGTATAGTGG - Intergenic
1158307657 18:56124698-56124720 CATGGTACACACAGGTACCTGGG + Intergenic
1161489275 19:4552938-4552960 CAGTGTCCCCACATGTACAATGG - Intronic
1162925156 19:13927153-13927175 CACTATACACACATGCACACAGG + Exonic
925397148 2:3542859-3542881 CATTGCACACACATATTTAAAGG - Intronic
926454622 2:13050736-13050758 AATTGTACCCAACTGTACAATGG - Intergenic
928136459 2:28691591-28691613 CATTTTCCTCATATGTACAATGG - Intergenic
928788556 2:34921446-34921468 TATTATACACACAAGTACTAGGG + Intergenic
929324677 2:40594841-40594863 ATGTGTACACACATGCACAAAGG - Intronic
929554814 2:42919564-42919586 CTATGTGCACACATGTACACCGG - Intergenic
930375080 2:50554852-50554874 CTTTGAACAAATATGTACAATGG + Intronic
931445306 2:62322362-62322384 CATGGTACATACAGATACAATGG - Intergenic
931830752 2:66048684-66048706 CATTACACACACATGCACACAGG - Intergenic
934155370 2:89194762-89194784 CATGGTTCAGACATATACAAAGG - Intergenic
935389046 2:102531339-102531361 CAATGTGCACACATCTTCAAAGG - Intronic
935868293 2:107416280-107416302 CACTGTACAGAAATGCACAATGG - Intergenic
936905490 2:117531554-117531576 CATTGAGCACACATGAACATAGG + Intergenic
937256975 2:120562520-120562542 CCTTGCACACTCATGTACATAGG + Intergenic
940984338 2:160037683-160037705 CATGATACAGACATGTGCAAAGG - Intronic
942709754 2:178819929-178819951 CAGTGTACACACAAGTTGAATGG + Intronic
944117400 2:196204156-196204178 AATTGTACACTCATGTTCATAGG - Intronic
944725198 2:202464259-202464281 AAATGTACACACTTGTGCAATGG + Intronic
945829369 2:214764454-214764476 CAATGCAAAGACATGTACAAAGG + Intronic
946911202 2:224463043-224463065 AATTGTACAATCATGTAAAAGGG + Intergenic
948193451 2:236077698-236077720 CATTGCAAACCCATGTCCAAGGG - Intronic
949024101 2:241757181-241757203 CCTTTTACACACATGTAAACAGG + Intronic
1170660217 20:18331578-18331600 CTAATTACACACATGTACAATGG + Intergenic
1172490712 20:35335126-35335148 CATTATAAACAAATGAACAATGG + Intronic
1173588491 20:44204686-44204708 CATTGAACACACGTGGACATGGG - Intronic
1174598143 20:51701247-51701269 TAATGTACACACATATACATAGG - Intronic
1175136716 20:56829705-56829727 CATTCAACACTCATGTACTAAGG - Intergenic
1175531285 20:59675306-59675328 CTGTGTACCCACCTGTACAATGG - Intronic
1175610132 20:60344254-60344276 CATTCTACACACAAGGACAGTGG + Intergenic
1181574360 22:23784226-23784248 CACTGTACACACATTTACAATGG - Exonic
1182019277 22:27067365-27067387 CATTGTTCTCACCTGTAAAATGG - Intergenic
1182220007 22:28751082-28751104 CATGGTACACACAGAGACAAAGG + Intronic
949185660 3:1188360-1188382 CATTGTACATTCATGTATTAAGG + Intronic
949185735 3:1189386-1189408 CATTGTACATTCATGTATTAAGG + Intronic
950693580 3:14680601-14680623 CATTGTACACACGTTAAAAAGGG + Intronic
952755193 3:36859462-36859484 CAATGAAAACACATGGACAAAGG - Intronic
955561655 3:60197744-60197766 CATTGGAGAGAAATGTACAAAGG - Intronic
956010188 3:64822363-64822385 TATTGTACAAATATTTACAAGGG - Intergenic
957481242 3:80798173-80798195 CATTGTAGACACATAGATAAAGG - Intergenic
958097739 3:88969216-88969238 CACTGTACTCATATGTAGAAAGG - Intergenic
958270291 3:91491205-91491227 CATAGCACACACATGTGCTATGG + Intergenic
959822640 3:110754823-110754845 CATTGTATACAGATGTGCCAAGG + Intergenic
960377358 3:116919703-116919725 CACAATACACACAAGTACAATGG + Intronic
961458575 3:127036320-127036342 CATGCTACTCACATGGACAAGGG - Exonic
961625569 3:128261098-128261120 CATTGTTGACACCTGGACAATGG - Intronic
963543796 3:146629167-146629189 CATTATACAAAAATGTATAAAGG - Intergenic
965129030 3:164670658-164670680 CATTGAGAACACATGGACAAAGG + Intergenic
965339433 3:167468709-167468731 CATTGTACAAATAAGTAAAATGG - Intronic
965518026 3:169643119-169643141 CATTTTACACATTTATACAAGGG + Intronic
965992404 3:174836035-174836057 CTTTGTACACTCATGTTCATAGG + Intronic
966052896 3:175642853-175642875 CAAAGTACACAAATGTAAAATGG + Intronic
966580838 3:181560833-181560855 TATTGTACATACATGTAAATGGG + Intergenic
966831784 3:184016692-184016714 TGTTGTCCAGACATGTACAAGGG + Intronic
969838995 4:9866796-9866818 CAGTTTACCCACATGTAAAATGG - Intronic
969962904 4:10964072-10964094 ACTTGTACACACATGAACACAGG + Intergenic
970751893 4:19373386-19373408 TATTGTATACACAAGTATAATGG + Intergenic
975267687 4:72390414-72390436 CAGTTTTCACACATGTAAAATGG - Intronic
975309924 4:72892364-72892386 CAATGTACAGAAATGTACAGAGG - Intergenic
975321913 4:73018379-73018401 AAGTGTACACACATGCACATAGG + Intergenic
976243430 4:82983652-82983674 CATAGTACAAACATGAATAATGG + Intronic
977533979 4:98235075-98235097 CATTGTGCACACAAGCTCAAGGG + Intergenic
978188680 4:105888088-105888110 TTTTGTAGACACATGGACAAGGG - Intronic
978338568 4:107696870-107696892 CATTGTAGACACTTGTAGGATGG - Intronic
978837188 4:113165051-113165073 TATTGTACACAAATATCCAAAGG - Intronic
978913060 4:114088509-114088531 CAGTGTACTCATATGTAAAATGG - Intergenic
979128771 4:117012089-117012111 CATTATACACAAATATATAAAGG - Intergenic
982638785 4:157930381-157930403 CATTCTACAAAGATTTACAATGG - Intergenic
985672034 5:1211798-1211820 CACAGTACACACATGCACACAGG - Intronic
988525654 5:31984903-31984925 CATTATAGCCAAATGTACAATGG + Intronic
988765149 5:34365003-34365025 CAATGGATACTCATGTACAATGG - Intergenic
989862802 5:46402537-46402559 CATTGAAAACACATGGACACAGG + Intergenic
989866140 5:46510865-46510887 CATTGAACACACACATTCAAAGG - Intergenic
990228265 5:53681292-53681314 CAGTTTACTCACCTGTACAAGGG + Intronic
993509896 5:88758083-88758105 GATTGAACATACAGGTACAATGG - Intronic
994743168 5:103646347-103646369 CATTGTTGACACAGGTAAAAGGG - Intergenic
994884791 5:105546447-105546469 CTCTGGACTCACATGTACAAAGG - Intergenic
995702166 5:114948260-114948282 CCATGTACACACATCTAAAAGGG + Intergenic
996053615 5:118960617-118960639 CATTGAACATACATGTGCATGGG - Intronic
997859906 5:137406796-137406818 CAGTGTTCACACCTGTAAAATGG + Intronic
998237657 5:140413360-140413382 CATTTAACATACATGTACAGTGG - Intronic
998405368 5:141871209-141871231 CAGTGTACCCAGATGTGCAAAGG - Intronic
999891060 5:155979239-155979261 CATTAAACACTCATCTACAAAGG - Intronic
1001162490 5:169333044-169333066 CTTTGTACACATTTGTAGAAGGG + Intergenic
1001185668 5:169569284-169569306 CACTGTCCACACATGTAAAAGGG - Intergenic
1005796679 6:29370132-29370154 CATTGAGCACACATGAACATAGG - Intronic
1007011394 6:38421514-38421536 CCTTAGACATACATGTACAAAGG - Intronic
1008037196 6:46758194-46758216 CATTATACACACATAGACAATGG - Intronic
1008984858 6:57530150-57530172 CATAGCACACACATGTGCTATGG - Intronic
1009172904 6:60423094-60423116 CATAGCACACACATGTGCTATGG - Intergenic
1011636752 6:89381805-89381827 CATTGTAATCACATATACATGGG - Intronic
1012020360 6:93910373-93910395 CATTGTATTAACATGTACAGGGG + Intergenic
1012366892 6:98452121-98452143 TAGTGGACACACATGTACAATGG - Intergenic
1013745923 6:113345959-113345981 CAAGATACAAACATGTACAATGG - Intergenic
1013795653 6:113885633-113885655 CATTAAACACACATGTACAATGG - Intergenic
1014405895 6:121050113-121050135 CATTGTATACAAAAGGACAACGG - Intergenic
1015310975 6:131767029-131767051 CATAGTACAAACCTGTGCAAAGG - Intergenic
1015373537 6:132483465-132483487 CAGTGTACATGCATGTTCAATGG - Intronic
1015945168 6:138492287-138492309 CATTGTACACACAGGGAGAGAGG - Intronic
1019906929 7:4071879-4071901 CTGTGTACACACATCTACCAAGG - Intronic
1020161343 7:5774667-5774689 CATTGTAATCACAAGTACACAGG + Intronic
1023869678 7:44256430-44256452 AGTTGTACACACATGCACACAGG - Intronic
1024919128 7:54538821-54538843 CATTGTACACATATGGAAAGAGG + Intergenic
1027545500 7:79522780-79522802 CATTATACACACAAGGAAAATGG - Intergenic
1028528992 7:91817458-91817480 CATTGTACAAAAAAGTCCAAGGG + Intronic
1028952531 7:96653070-96653092 CATTTTGCACATATGTAAAATGG - Intronic
1030295497 7:107921863-107921885 CAATGAAAACACATGGACAAGGG - Intronic
1031150434 7:118047896-118047918 AATTGTACATACATGCAAAAGGG - Intergenic
1032339839 7:131060237-131060259 CAGTGTACACACATGTAATCTGG - Intergenic
1034015315 7:147577512-147577534 CTTTGTATACACAAGTAGAATGG - Intronic
1039794650 8:40902513-40902535 TGTTGTAAACACATGTTCAATGG - Intergenic
1039970542 8:42318299-42318321 CATTGGACACATATGTATATAGG - Intronic
1040706204 8:50131529-50131551 GTGTGTACACATATGTACAATGG - Intronic
1042305995 8:67333654-67333676 CATTCTACACACACATACATGGG - Intronic
1043684436 8:83068693-83068715 CATTGTACACACATATGTCATGG + Intergenic
1048813425 8:138309149-138309171 CAATGTACACATATGGACACTGG + Intronic
1050420913 9:5464535-5464557 CATGGTACACAGATGTTCAGAGG - Intronic
1052414964 9:28166675-28166697 CATTGTACAAACATGTATTGGGG + Intronic
1055408047 9:75995340-75995362 CATTCAACACACATTTATAAAGG - Intronic
1056412760 9:86348364-86348386 CATTGTCCCCATCTGTACAATGG - Intronic
1056416810 9:86385297-86385319 GGTTCTACACACATGTACATAGG + Intergenic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1059666054 9:116447643-116447665 CAAGGTACTCACCTGTACAACGG + Intronic
1059751183 9:117248955-117248977 CAATTTCCACATATGTACAATGG + Intronic
1061509900 9:131054035-131054057 CATTTTACACACATACACTAGGG - Intronic
1186129224 X:6448387-6448409 CTTTGTACACACCTATACCATGG - Intergenic
1189928495 X:45983022-45983044 CAATGTACATACAAGTACATGGG - Intergenic
1191691462 X:63943385-63943407 CATTGTGCCCATATGTAAAATGG - Intergenic
1191749281 X:64523914-64523936 CAATGTAAACACATGGACACAGG + Intergenic
1192453609 X:71259284-71259306 CAGTGTCCACAAATGTAAAATGG + Intergenic
1192902986 X:75520355-75520377 CAGTTTACACATTTGTACAATGG + Intronic
1192957577 X:76089443-76089465 CAATGAACACACATGGACACAGG - Intergenic
1193704753 X:84807918-84807940 CATTGTAAACATATTTACTATGG - Intergenic
1197173245 X:123457412-123457434 CCTTGTACATACATGTCAAAGGG - Intronic
1198273635 X:135080078-135080100 CATTTTACACATAAGTAAAATGG + Intergenic
1198360589 X:135891858-135891880 AGTTGTACACACATGCACACAGG - Intronic
1198488058 X:137108229-137108251 CAATGAAAACACATGGACAAAGG + Intergenic
1199049265 X:143217571-143217593 CACTGTACACACAAGTTCACTGG + Intergenic
1199467692 X:148157753-148157775 AAATGTACACACATATACCAAGG - Intergenic