ID: 1140623483

View in Genome Browser
Species Human (GRCh38)
Location 16:76764384-76764406
Sequence ACTAATAAGCAGTTATAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140623481_1140623483 28 Left 1140623481 16:76764333-76764355 CCGCACTTGGCTAGATTATCAAT No data
Right 1140623483 16:76764384-76764406 ACTAATAAGCAGTTATAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140623483 Original CRISPR ACTAATAAGCAGTTATAGCA AGG Intergenic
No off target data available for this crispr