ID: 1140627246

View in Genome Browser
Species Human (GRCh38)
Location 16:76808979-76809001
Sequence CAGCAAAATTAGATGAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140627246_1140627249 7 Left 1140627246 16:76808979-76809001 CCAGAATTCATCTAATTTTGCTG No data
Right 1140627249 16:76809009-76809031 GCAGCTGATAAACAGACCATGGG No data
1140627246_1140627252 27 Left 1140627246 16:76808979-76809001 CCAGAATTCATCTAATTTTGCTG No data
Right 1140627252 16:76809029-76809051 GGGTTCCAGTGCAGGCAGCCTGG No data
1140627246_1140627248 6 Left 1140627246 16:76808979-76809001 CCAGAATTCATCTAATTTTGCTG No data
Right 1140627248 16:76809008-76809030 CGCAGCTGATAAACAGACCATGG No data
1140627246_1140627250 19 Left 1140627246 16:76808979-76809001 CCAGAATTCATCTAATTTTGCTG No data
Right 1140627250 16:76809021-76809043 CAGACCATGGGTTCCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140627246 Original CRISPR CAGCAAAATTAGATGAATTC TGG (reversed) Intergenic
No off target data available for this crispr