ID: 1140632353

View in Genome Browser
Species Human (GRCh38)
Location 16:76868858-76868880
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632349_1140632353 27 Left 1140632349 16:76868808-76868830 CCTCTGGGCAATAATATCTGGTA No data
Right 1140632353 16:76868858-76868880 CTATTACTGTTAGGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632353 Original CRISPR CTATTACTGTTAGGAGTGTC TGG Intergenic
No off target data available for this crispr