ID: 1140632615

View in Genome Browser
Species Human (GRCh38)
Location 16:76872273-76872295
Sequence CATGAAAGGCAGAACATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632615_1140632620 24 Left 1140632615 16:76872273-76872295 CCCTCTATGTTCTGCCTTTCATG No data
Right 1140632620 16:76872320-76872342 AAGATATTAACTGAATATCAAGG No data
1140632615_1140632621 25 Left 1140632615 16:76872273-76872295 CCCTCTATGTTCTGCCTTTCATG No data
Right 1140632621 16:76872321-76872343 AGATATTAACTGAATATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632615 Original CRISPR CATGAAAGGCAGAACATAGA GGG (reversed) Intergenic
No off target data available for this crispr