ID: 1140632620

View in Genome Browser
Species Human (GRCh38)
Location 16:76872320-76872342
Sequence AAGATATTAACTGAATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632613_1140632620 26 Left 1140632613 16:76872271-76872293 CCCCCTCTATGTTCTGCCTTTCA No data
Right 1140632620 16:76872320-76872342 AAGATATTAACTGAATATCAAGG No data
1140632612_1140632620 27 Left 1140632612 16:76872270-76872292 CCCCCCTCTATGTTCTGCCTTTC No data
Right 1140632620 16:76872320-76872342 AAGATATTAACTGAATATCAAGG No data
1140632615_1140632620 24 Left 1140632615 16:76872273-76872295 CCCTCTATGTTCTGCCTTTCATG No data
Right 1140632620 16:76872320-76872342 AAGATATTAACTGAATATCAAGG No data
1140632619_1140632620 10 Left 1140632619 16:76872287-76872309 CCTTTCATGGTAATCAAAGGAAA No data
Right 1140632620 16:76872320-76872342 AAGATATTAACTGAATATCAAGG No data
1140632616_1140632620 23 Left 1140632616 16:76872274-76872296 CCTCTATGTTCTGCCTTTCATGG No data
Right 1140632620 16:76872320-76872342 AAGATATTAACTGAATATCAAGG No data
1140632614_1140632620 25 Left 1140632614 16:76872272-76872294 CCCCTCTATGTTCTGCCTTTCAT No data
Right 1140632620 16:76872320-76872342 AAGATATTAACTGAATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632620 Original CRISPR AAGATATTAACTGAATATCA AGG Intergenic
No off target data available for this crispr