ID: 1140632776

View in Genome Browser
Species Human (GRCh38)
Location 16:76873702-76873724
Sequence AGCCATGTGTTGAAGATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632776_1140632778 -7 Left 1140632776 16:76873702-76873724 CCTGTGATCTTCAACACATGGCT No data
Right 1140632778 16:76873718-76873740 CATGGCTCCTAGGTTTTCCCAGG No data
1140632776_1140632784 30 Left 1140632776 16:76873702-76873724 CCTGTGATCTTCAACACATGGCT No data
Right 1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG No data
1140632776_1140632779 -6 Left 1140632776 16:76873702-76873724 CCTGTGATCTTCAACACATGGCT No data
Right 1140632779 16:76873719-76873741 ATGGCTCCTAGGTTTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632776 Original CRISPR AGCCATGTGTTGAAGATCAC AGG (reversed) Intergenic
No off target data available for this crispr