ID: 1140632781

View in Genome Browser
Species Human (GRCh38)
Location 16:76873735-76873757
Sequence GTGGATTGAAATTCATCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632781_1140632786 19 Left 1140632781 16:76873735-76873757 CCCAGGGATGAATTTCAATCCAC No data
Right 1140632786 16:76873777-76873799 GTTGCTTCTGTAGAAGAAATAGG No data
1140632781_1140632784 -3 Left 1140632781 16:76873735-76873757 CCCAGGGATGAATTTCAATCCAC No data
Right 1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632781 Original CRISPR GTGGATTGAAATTCATCCCT GGG (reversed) Intergenic
No off target data available for this crispr