ID: 1140632782

View in Genome Browser
Species Human (GRCh38)
Location 16:76873736-76873758
Sequence TGTGGATTGAAATTCATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632782_1140632784 -4 Left 1140632782 16:76873736-76873758 CCAGGGATGAATTTCAATCCACA No data
Right 1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG No data
1140632782_1140632786 18 Left 1140632782 16:76873736-76873758 CCAGGGATGAATTTCAATCCACA No data
Right 1140632786 16:76873777-76873799 GTTGCTTCTGTAGAAGAAATAGG No data
1140632782_1140632787 30 Left 1140632782 16:76873736-76873758 CCAGGGATGAATTTCAATCCACA No data
Right 1140632787 16:76873789-76873811 GAAGAAATAGGTCCTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632782 Original CRISPR TGTGGATTGAAATTCATCCC TGG (reversed) Intergenic
No off target data available for this crispr