ID: 1140632784

View in Genome Browser
Species Human (GRCh38)
Location 16:76873755-76873777
Sequence CACAGTCATCTCCAGAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632776_1140632784 30 Left 1140632776 16:76873702-76873724 CCTGTGATCTTCAACACATGGCT No data
Right 1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG No data
1140632781_1140632784 -3 Left 1140632781 16:76873735-76873757 CCCAGGGATGAATTTCAATCCAC No data
Right 1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG No data
1140632780_1140632784 7 Left 1140632780 16:76873725-76873747 CCTAGGTTTTCCCAGGGATGAAT No data
Right 1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG No data
1140632782_1140632784 -4 Left 1140632782 16:76873736-76873758 CCAGGGATGAATTTCAATCCACA No data
Right 1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632784 Original CRISPR CACAGTCATCTCCAGAAGTG TGG Intergenic
No off target data available for this crispr