ID: 1140632786

View in Genome Browser
Species Human (GRCh38)
Location 16:76873777-76873799
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632780_1140632786 29 Left 1140632780 16:76873725-76873747 CCTAGGTTTTCCCAGGGATGAAT No data
Right 1140632786 16:76873777-76873799 GTTGCTTCTGTAGAAGAAATAGG No data
1140632783_1140632786 0 Left 1140632783 16:76873754-76873776 CCACAGTCATCTCCAGAAGTGTG No data
Right 1140632786 16:76873777-76873799 GTTGCTTCTGTAGAAGAAATAGG No data
1140632781_1140632786 19 Left 1140632781 16:76873735-76873757 CCCAGGGATGAATTTCAATCCAC No data
Right 1140632786 16:76873777-76873799 GTTGCTTCTGTAGAAGAAATAGG No data
1140632782_1140632786 18 Left 1140632782 16:76873736-76873758 CCAGGGATGAATTTCAATCCACA No data
Right 1140632786 16:76873777-76873799 GTTGCTTCTGTAGAAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632786 Original CRISPR GTTGCTTCTGTAGAAGAAAT AGG Intergenic