ID: 1140632788

View in Genome Browser
Species Human (GRCh38)
Location 16:76873799-76873821
Sequence GTCCTTTTTGTGGCTGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140632783_1140632788 22 Left 1140632783 16:76873754-76873776 CCACAGTCATCTCCAGAAGTGTG No data
Right 1140632788 16:76873799-76873821 GTCCTTTTTGTGGCTGAATTTGG No data
1140632785_1140632788 10 Left 1140632785 16:76873766-76873788 CCAGAAGTGTGGTTGCTTCTGTA No data
Right 1140632788 16:76873799-76873821 GTCCTTTTTGTGGCTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140632788 Original CRISPR GTCCTTTTTGTGGCTGAATT TGG Intergenic
No off target data available for this crispr