ID: 1140647578

View in Genome Browser
Species Human (GRCh38)
Location 16:77049816-77049838
Sequence TGTCACAAGTAACCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140647573_1140647578 3 Left 1140647573 16:77049790-77049812 CCCTTCCTTCCATTTTTTTGTCC No data
Right 1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG No data
1140647572_1140647578 10 Left 1140647572 16:77049783-77049805 CCTTTATCCCTTCCTTCCATTTT No data
Right 1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG No data
1140647575_1140647578 -2 Left 1140647575 16:77049795-77049817 CCTTCCATTTTTTTGTCCAGCTG No data
Right 1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG No data
1140647574_1140647578 2 Left 1140647574 16:77049791-77049813 CCTTCCTTCCATTTTTTTGTCCA No data
Right 1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG No data
1140647576_1140647578 -6 Left 1140647576 16:77049799-77049821 CCATTTTTTTGTCCAGCTGTCAC No data
Right 1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140647578 Original CRISPR TGTCACAAGTAACCAAAAGC AGG Intergenic
No off target data available for this crispr