ID: 1140655643

View in Genome Browser
Species Human (GRCh38)
Location 16:77136567-77136589
Sequence CTGAGTTTCAATGAGTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140655640_1140655643 0 Left 1140655640 16:77136544-77136566 CCAAGAGGCTAAAGGGAAACAGG No data
Right 1140655643 16:77136567-77136589 CTGAGTTTCAATGAGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140655643 Original CRISPR CTGAGTTTCAATGAGTAAGT GGG Intergenic
No off target data available for this crispr