ID: 1140657040

View in Genome Browser
Species Human (GRCh38)
Location 16:77151687-77151709
Sequence AAGGAGAGGAAAAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140657040_1140657043 -6 Left 1140657040 16:77151687-77151709 CCATTCTCATTTTTCCTCTCCTT No data
Right 1140657043 16:77151704-77151726 CTCCTTACACCACCTGCCCAGGG No data
1140657040_1140657042 -7 Left 1140657040 16:77151687-77151709 CCATTCTCATTTTTCCTCTCCTT No data
Right 1140657042 16:77151703-77151725 TCTCCTTACACCACCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140657040 Original CRISPR AAGGAGAGGAAAAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr