ID: 1140661518

View in Genome Browser
Species Human (GRCh38)
Location 16:77194327-77194349
Sequence TTCCCTAGAGGACCACAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140661511_1140661518 -6 Left 1140661511 16:77194310-77194332 CCCTTCTTACCCCTTCCTTCCCT 0: 1
1: 0
2: 50
3: 484
4: 3639
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661505_1140661518 13 Left 1140661505 16:77194291-77194313 CCTGATCCAGCTGTACCCCCCCT 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661510_1140661518 -5 Left 1140661510 16:77194309-77194331 CCCCTTCTTACCCCTTCCTTCCC 0: 1
1: 0
2: 18
3: 227
4: 1929
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661506_1140661518 7 Left 1140661506 16:77194297-77194319 CCAGCTGTACCCCCCCTTCTTAC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661512_1140661518 -7 Left 1140661512 16:77194311-77194333 CCTTCTTACCCCTTCCTTCCCTA 0: 1
1: 0
2: 7
3: 104
4: 989
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661507_1140661518 -2 Left 1140661507 16:77194306-77194328 CCCCCCCTTCTTACCCCTTCCTT 0: 1
1: 0
2: 7
3: 219
4: 1787
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661503_1140661518 26 Left 1140661503 16:77194278-77194300 CCCTCTGGTCATTCCTGATCCAG 0: 1
1: 0
2: 1
3: 23
4: 174
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661509_1140661518 -4 Left 1140661509 16:77194308-77194330 CCCCCTTCTTACCCCTTCCTTCC 0: 1
1: 0
2: 29
3: 212
4: 1636
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661508_1140661518 -3 Left 1140661508 16:77194307-77194329 CCCCCCTTCTTACCCCTTCCTTC 0: 1
1: 4
2: 30
3: 298
4: 1729
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1140661504_1140661518 25 Left 1140661504 16:77194279-77194301 CCTCTGGTCATTCCTGATCCAGC 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140661518 Original CRISPR TTCCCTAGAGGACCACAAGC TGG Exonic
900502894 1:3015299-3015321 TGCCCTGGAGGAACACAGGCAGG - Intergenic
909028445 1:70510288-70510310 TTCCCTCAAGGACCACTAGATGG - Intergenic
912389819 1:109295195-109295217 CTCCCTAGAGATCCGCAAGCCGG - Exonic
912439235 1:109686203-109686225 CTCCCCACAGGACCACAGGCAGG - Intronic
913669844 1:121086908-121086930 TCCCCTAGAGGAGCAGAGGCTGG + Intergenic
914021607 1:143874306-143874328 TCCCCTAGAGGAGCAGAGGCTGG + Intergenic
914660095 1:149782257-149782279 TCCCCTAGAGGAGCAGAGGCTGG + Intergenic
915719252 1:157972040-157972062 TTCAGAAGAGGAACACAAGCTGG - Intergenic
915883392 1:159697558-159697580 TCGCCTAGAGGAGAACAAGCTGG + Intergenic
920798687 1:209165900-209165922 TTCCTTAGATGACCATAATCAGG - Intergenic
1072862988 10:99026025-99026047 TTCACTAGAGGAACACAGGAAGG + Intronic
1073851422 10:107623332-107623354 TTCCCTACAGGAACACGTGCAGG + Intergenic
1076751764 10:132546849-132546871 GTGCCTACAGGACCAAAAGCAGG - Intronic
1077888335 11:6402206-6402228 TTCCCTGCAGGACCAGAAGCAGG + Exonic
1078363364 11:10687349-10687371 TTCCCTAGAGAAACAGAAGAGGG - Intronic
1079423920 11:20322330-20322352 CTCTCTAGAGGACCACAGGATGG - Intergenic
1083008828 11:59374552-59374574 GTCCTTAGAGAACCACAAGGAGG + Intergenic
1083164332 11:60874383-60874405 TGCCCTACGGGACCAGAAGCAGG - Intronic
1089917985 11:122177622-122177644 TACCCTAGAGGACCAACTGCAGG - Intergenic
1095486472 12:42689839-42689861 GTTCCTGGAGGACCACACGCTGG + Intergenic
1096147139 12:49286427-49286449 ATGCCTGGAGCACCACAAGCTGG + Intergenic
1098859228 12:75688809-75688831 TTCTCTAGAGGGCCACAACTGGG + Intergenic
1101077281 12:101144189-101144211 TTCCCTATAGAAACACAACCAGG + Intergenic
1101798574 12:108000833-108000855 TTCCCTAGGGGGCCAAAAGGAGG - Intergenic
1105474680 13:20719923-20719945 TTGAGTAGAGGAACACAAGCCGG - Intronic
1110889212 13:80677539-80677561 TTCACTAGAGGAAGACAAGAAGG - Intergenic
1112352288 13:98646254-98646276 TTCCCTGCAGGACCACAGCCTGG - Intergenic
1129148372 15:73670522-73670544 TTGCCTAGAGGAGCCAAAGCTGG - Intergenic
1132006967 15:98236014-98236036 TTCCCTAGAGCAAGATAAGCAGG + Intergenic
1132371179 15:101300447-101300469 TTCCAGAGAGGACCACCAGGTGG + Intronic
1135608832 16:23847184-23847206 TTCCCTAGAGGCCCAAAGTCTGG - Intronic
1138308956 16:56006892-56006914 TGCCCTAGAGGAAGAAAAGCTGG + Intergenic
1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG + Exonic
1141109267 16:81258580-81258602 TTCCCTGGAGGGACACAAACAGG + Intronic
1141150857 16:81563875-81563897 TTCCATTGCAGACCACAAGCTGG + Intronic
1144455218 17:15413012-15413034 TTCCCTGGAGGGCCACAAGTGGG + Intergenic
1145875845 17:28317952-28317974 TTCCCCACAGGGCCACAGGCGGG + Intergenic
1152885131 17:82845135-82845157 TTCCCTAGGGGCACACAGGCTGG + Intronic
1154285552 18:13053072-13053094 TGCCCTGGAGGACCGCAAGGTGG + Exonic
1157388195 18:47278316-47278338 TTCATTAGAGGAGCACACGCTGG + Intergenic
1160816171 19:1036748-1036770 TTCCCTAGAGACCCACAGCCAGG - Intronic
1162752590 19:12838176-12838198 CTCCCTGGAGGAGCAGAAGCAGG - Intronic
1162842978 19:13369910-13369932 TTTCCCAGAGGATCACCAGCAGG - Intronic
1166893687 19:46009905-46009927 TTCCCAAGATGGCCACAAGGGGG + Intronic
1168520711 19:57048306-57048328 TTCCCTAAAGAACTAAAAGCAGG + Intergenic
927498671 2:23567118-23567140 TTCCCTTCAGGCCCACAAACAGG - Intronic
929063597 2:37949288-37949310 TTCCCTTCAGGACCAAGAGCAGG + Intronic
929503899 2:42513410-42513432 TTCCAGAGAGGACCACTAGGAGG + Intronic
930503478 2:52253807-52253829 TGCCCTGGAGGAACACAAGTAGG - Intergenic
932447495 2:71789997-71790019 TTCCCTTGAGCAACACAAGATGG + Intergenic
932944365 2:76210089-76210111 TTCGTTAGAGGACCACACTCAGG - Intergenic
942769357 2:179497614-179497636 TTCACTAGAGGAACACAAAAAGG + Intronic
944155104 2:196599409-196599431 TTCCATATAAAACCACAAGCAGG - Intergenic
944929137 2:204498730-204498752 TTTCATAGAGGTCCACAAGATGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
948723449 2:239918058-239918080 TTCCCCTGAGGACCAGGAGCAGG - Intronic
1169358109 20:4924688-4924710 TGCCCTTGAGGCCCACATGCAGG + Intronic
1174045070 20:47727509-47727531 TTCCCTAGTGGACCACAGACTGG - Intronic
1178629096 21:34243766-34243788 TTCCCCAGGAGACCACAAGAGGG - Intergenic
1179540171 21:42078793-42078815 TTCCCTAGAGGGCCACTGGCAGG + Intronic
1182193606 22:28490675-28490697 TTTAATAGAGGACCACAAGATGG + Intronic
1182450656 22:30418644-30418666 TTCCCAAGAGGAGCAGAGGCAGG + Intronic
1183903363 22:41022254-41022276 TTCCGCAGAGGACGACAATCCGG + Intergenic
1184046907 22:41977469-41977491 TTCCCTTGGAGACCACCAGCTGG - Intronic
1184167173 22:42736670-42736692 TTCCAGAGAGGACCTCAAGACGG + Intergenic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
949679176 3:6492870-6492892 TTCCCTAGAGAACTACCTGCAGG - Intergenic
951027596 3:17846185-17846207 TTCCCTAGAGGATCACAGATGGG - Intronic
953961038 3:47265784-47265806 TGCCCTTGGGGACCAGAAGCGGG - Exonic
954157502 3:48694714-48694736 TTTCCTGGAGGACAAAAAGCAGG + Intronic
956459306 3:69454854-69454876 TTCCCTAGTGGATCCCACGCAGG - Intronic
960872755 3:122266244-122266266 TACCCTAAAAGACCACAAGATGG + Intronic
961752672 3:129106444-129106466 TTCCCTGGAGGACCACAGCATGG - Intronic
963005742 3:140724802-140724824 TTCCCCAGAGGGCCATAAGCAGG - Intergenic
967268975 3:187717465-187717487 TTCCCTTTAGGACCCCAAGAAGG - Intronic
968227695 3:196985511-196985533 CTCCCTAGAAAATCACAAGCTGG + Intergenic
968629181 4:1641419-1641441 CTCCCTAGAGGCCCACAGGTTGG + Exonic
969060171 4:4427871-4427893 GTCCCTAGAGGAAGAGAAGCAGG + Intronic
971251619 4:24977261-24977283 TTCCATCGAGGACTCCAAGCTGG + Intronic
978095118 4:104766920-104766942 TTCCATAGGTAACCACAAGCTGG + Intergenic
981136278 4:141213973-141213995 TTCCCTAGTGGATCCCACGCTGG - Intergenic
981578405 4:146228433-146228455 GTCCCTGGAGGTCCACAGGCTGG + Exonic
982781009 4:159491649-159491671 TTCAGGAGAGGACTACAAGCAGG + Intergenic
995278346 5:110304894-110304916 TTCACTAGAGGAAGACAAGAAGG - Intronic
995869917 5:116734005-116734027 TGCCCTAGAGGAAGACATGCTGG - Intergenic
997010778 5:129874910-129874932 TTCCCCTGAGAACTACAAGCAGG - Intergenic
997943584 5:138179824-138179846 CTCCCTAGAGGACAAGCAGCAGG + Exonic
1001402435 5:171453511-171453533 TTCCAAAGAGGTCCACAAGGGGG - Intronic
1003382911 6:5641051-5641073 TTCCCCAGAGGATGACAAGCTGG - Intronic
1006866171 6:37210622-37210644 TTCCCCAAATGACCACAAGATGG - Intergenic
1009725428 6:67531332-67531354 TACTCCAGAGGAACACAAGCTGG + Intergenic
1013721981 6:113041218-113041240 TTCCCTAGAGGACAAGAACAAGG - Intergenic
1016352032 6:143178390-143178412 TTCCATAGAGGAAATCAAGCTGG - Intronic
1019616625 7:1965864-1965886 GTCCCTGGAGGACCACAAAGGGG + Intronic
1020056031 7:5117943-5117965 TTCCCTTGAGGAGGACAAGCTGG + Intergenic
1031996726 7:128237197-128237219 TTCCCTAGAGCAGCAAAAGATGG - Intergenic
1032785771 7:135198148-135198170 TGCCCTAGAGGAAAAGAAGCTGG + Exonic
1035044619 7:155955465-155955487 TTTCCTTGTGGACCACTAGCTGG + Intergenic
1036755896 8:11470955-11470977 TTCCCTAGAAGACAGAAAGCTGG - Intronic
1038166954 8:25094734-25094756 TTCACTAGAAGACCTCAAGGTGG + Intergenic
1038218118 8:25581679-25581701 TTCCCAAGAGGAGCACAAAGGGG - Intergenic
1039620499 8:38992752-38992774 TTCCTTAGAGAACTACATGCAGG - Intronic
1041183734 8:55275866-55275888 CTCACTAGAGGACCATGAGCCGG + Intronic
1042377554 8:68071808-68071830 TGCCCTAGTGGAAAACAAGCAGG - Intronic
1043405207 8:79924872-79924894 TTCCCTAGATGATCATAAGCAGG + Intronic
1048283078 8:133119754-133119776 TTCCCTCGAGGACAAGCAGCTGG + Intronic
1049737230 8:144215519-144215541 CTCCCTAGAGGACCACTTCCTGG + Intronic
1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG + Intergenic
1056932677 9:90891873-90891895 TTCCCTCCAGGACCACACCCTGG - Intronic
1058357809 9:104104866-104104888 TGCCCAGGAGGACCACAGGCAGG + Intronic
1058669929 9:107352226-107352248 TTTCCCAGAGGACCACAAAGTGG + Intergenic
1059245334 9:112844845-112844867 TTCCCCACAGGGCCACAAGGTGG + Intronic
1060033636 9:120236410-120236432 ATGCCTATAGGACCAGAAGCTGG - Intergenic
1062693211 9:137856442-137856464 GGCCCTAGAGGAGCACATGCAGG + Intronic
1186237839 X:7532587-7532609 TTCCCAAAAGGAGCACAAGAAGG - Intergenic
1187933632 X:24315360-24315382 TTCCCTAGAGGCAAAGAAGCTGG + Intergenic
1189368902 X:40412326-40412348 TTGCCTTGAGGACCCCAGGCTGG + Intergenic
1192369917 X:70504645-70504667 TTCCCAAGAGGTACACAAGGTGG + Exonic
1193175381 X:78386570-78386592 TTCACTAGAGGAAGACAAGAAGG + Intergenic
1195172010 X:102278784-102278806 TTCACTAGAGGAAGACAAGAAGG - Intergenic
1195186850 X:102408309-102408331 TTCACTAGAGGAAGACAAGAAGG + Intronic
1196714431 X:118797881-118797903 CTCCATATAGGAGCACAAGCTGG + Intergenic
1197633023 X:128884104-128884126 TTCCATACAGTACCACCAGCTGG + Intergenic
1197677335 X:129344301-129344323 TTCACTAGAGGAAGACAAGAAGG + Intergenic
1199415316 X:147575421-147575443 TTCACTAGAGGAAGACAAGAAGG + Intergenic
1199711504 X:150473042-150473064 GTCCCCAGAGGCCCATAAGCTGG + Intronic