ID: 1140664304

View in Genome Browser
Species Human (GRCh38)
Location 16:77213671-77213693
Sequence CCGCTCAGATACCACTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140664304_1140664314 24 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664314 16:77213718-77213740 GGTGAGCCCTGTGGGTGTCTGGG No data
1140664304_1140664311 15 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664311 16:77213709-77213731 AAGCGAGGGGGTGAGCCCTGTGG No data
1140664304_1140664310 3 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664310 16:77213697-77213719 AGCGAGGTAGAGAAGCGAGGGGG No data
1140664304_1140664315 25 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664315 16:77213719-77213741 GTGAGCCCTGTGGGTGTCTGGGG No data
1140664304_1140664309 2 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664309 16:77213696-77213718 AAGCGAGGTAGAGAAGCGAGGGG No data
1140664304_1140664307 0 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664307 16:77213694-77213716 AGAAGCGAGGTAGAGAAGCGAGG No data
1140664304_1140664308 1 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664308 16:77213695-77213717 GAAGCGAGGTAGAGAAGCGAGGG No data
1140664304_1140664313 23 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664313 16:77213717-77213739 GGGTGAGCCCTGTGGGTGTCTGG No data
1140664304_1140664312 16 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664312 16:77213710-77213732 AGCGAGGGGGTGAGCCCTGTGGG No data
1140664304_1140664317 30 Left 1140664304 16:77213671-77213693 CCTAGGAAGTGGTATCTGAGCGG No data
Right 1140664317 16:77213724-77213746 CCCTGTGGGTGTCTGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140664304 Original CRISPR CCGCTCAGATACCACTTCCT AGG (reversed) Intergenic
No off target data available for this crispr