ID: 1140665792

View in Genome Browser
Species Human (GRCh38)
Location 16:77226048-77226070
Sequence TGCCCGGAATCCCTTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140665789_1140665792 30 Left 1140665789 16:77225995-77226017 CCACTGATTCTCAAACTGCACTA No data
Right 1140665792 16:77226048-77226070 TGCCCGGAATCCCTTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140665792 Original CRISPR TGCCCGGAATCCCTTTCAGA AGG Intergenic
No off target data available for this crispr