ID: 1140666119

View in Genome Browser
Species Human (GRCh38)
Location 16:77229149-77229171
Sequence GACTAAAGGAGGTGGGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140666113_1140666119 13 Left 1140666113 16:77229113-77229135 CCTCTGAACATGGTGACATTTAA No data
Right 1140666119 16:77229149-77229171 GACTAAAGGAGGTGGGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140666119 Original CRISPR GACTAAAGGAGGTGGGTATA TGG Intergenic
No off target data available for this crispr