ID: 1140671794

View in Genome Browser
Species Human (GRCh38)
Location 16:77286896-77286918
Sequence CCTTGGGGAAGCCATCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140671794_1140671801 7 Left 1140671794 16:77286896-77286918 CCATAAGGATGGCTTCCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1140671801 16:77286926-77286948 CCAACCAAGATACCCAGATAAGG 0: 1
1: 0
2: 1
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140671794 Original CRISPR CCTTGGGGAAGCCATCCTTA TGG (reversed) Intronic
900788232 1:4663072-4663094 GTTTGGGGAAACCATCCTCATGG + Intronic
901441585 1:9281528-9281550 CCTTGGGGCTGCCATCCCTTGGG - Intergenic
901446413 1:9310857-9310879 GCTTGGGGAAGTCATCCTAAGGG + Intronic
905909145 1:41641814-41641836 CCTTTGGGATGCCATTTTTAGGG + Intronic
906186524 1:43866231-43866253 CCTGGGAGAAGCCATCTTTTGGG + Intronic
908364581 1:63406471-63406493 CCTTAGAGAAGCCATGCTTTTGG + Intronic
913237219 1:116795549-116795571 CCTTGGGGGAGCACTCCTCAGGG + Intergenic
914916928 1:151824679-151824701 CCTTGGGGATGCCTGCCTTAGGG + Intronic
915461937 1:156075663-156075685 CTTTGGGGACACCATCCTTCTGG - Exonic
916408249 1:164518956-164518978 CCTGTGGGAAGCCATTCTCAAGG - Intergenic
920207390 1:204302524-204302546 CCTTGGGGAAAGCCTCCTTGGGG + Intronic
921567066 1:216734026-216734048 CCTTTGGGAAGCCTTCCTGAAGG + Intronic
921898396 1:220424528-220424550 CCTTCAGGATGCCTTCCTTATGG + Intergenic
922588303 1:226752590-226752612 CCATGGAGAAGCCATCTTTGTGG - Intergenic
923063862 1:230500572-230500594 CCTTGGGGATGACATCTTTCTGG + Intergenic
1063387264 10:5623852-5623874 CTTTGGGGAAGTGATCCTTCTGG - Intergenic
1064831724 10:19476133-19476155 AATTGTGGAAGCCATCCTTGGGG + Intronic
1069944037 10:71973764-71973786 ACTTGGGGAAGCCTTCCTAGAGG + Intronic
1071735160 10:88290666-88290688 CATTGGTGAAGCCATTCTAAAGG + Intronic
1071959951 10:90800471-90800493 CCTTGGGGAAGAAAGCCTGATGG - Intronic
1072186132 10:93040884-93040906 CCTTGGGGAAACCAACATTTAGG - Intronic
1073511332 10:104044489-104044511 ACTTGGGGAAACCATTCTTTAGG + Intronic
1075086274 10:119416311-119416333 CCTTGGCGACGCCATCCTCGGGG + Intronic
1079007263 11:16800788-16800810 GCTTGGGGAAGGGATCCTCAAGG + Intronic
1081761225 11:45577540-45577562 CCTTGGGGAAGCTCTTCTCAGGG + Intergenic
1083325385 11:61870384-61870406 CCTGGGGCAAGCCATCCCCACGG - Intergenic
1083736024 11:64681932-64681954 CCCTGGGGACTCCATCCTTAGGG + Intronic
1083736069 11:64682112-64682134 CCTTGGGGACTCCATTCTTGGGG + Intronic
1083736148 11:64682440-64682462 CCTTGGGGACTCCATCCTCGGGG + Intronic
1086830997 11:91563412-91563434 CTTTTGGGAAGCCATGCTAATGG + Intergenic
1086866617 11:91987169-91987191 CCTTGGGCTAGCAATCCTAAGGG - Intergenic
1091157233 11:133385009-133385031 CCTTGTGGAACCCCTCCTTGTGG + Intronic
1096417485 12:51426111-51426133 CCTCGGGGAAACCATCCCTGAGG - Intronic
1101553504 12:105785299-105785321 CCTGGGGGAAGCAATCCTGCGGG - Intergenic
1102509193 12:113402816-113402838 CCTTGGGGCAGGGATCCTTGGGG - Intronic
1110793533 13:79611881-79611903 GCCTCTGGAAGCCATCCTTAAGG + Intergenic
1110835028 13:80073643-80073665 TCCAGGGAAAGCCATCCTTAGGG + Intergenic
1111533494 13:89571738-89571760 CCTTGGGGAAGACATCTTTCTGG - Intergenic
1113079881 13:106507712-106507734 CCTTGGCAAAGTCTTCCTTAAGG - Intronic
1115946780 14:38670794-38670816 CCCTGGGGAAGTCATAGTTAGGG - Intergenic
1119381627 14:74232896-74232918 CTTTGGGGAAGCTACCCTCAAGG + Intergenic
1129868910 15:78928712-78928734 CCTGGGGGAGGCCACCCTCAGGG + Intronic
1131779850 15:95844307-95844329 CCTTGGGGAAACCAGCCCCATGG - Intergenic
1132229470 15:100171048-100171070 CCTAGGGGAAGCCATTTTAATGG + Intronic
1132378367 15:101348031-101348053 CCTTGGGTAAACCTTCCTTCTGG + Intronic
1133264664 16:4575899-4575921 CCTTGGGGGCCCCATCCTTGCGG - Exonic
1134249500 16:12564543-12564565 CCTTTGGCAACCCATTCTTATGG + Intronic
1136379857 16:29888231-29888253 CCTAGAGGAAGCCATTTTTAGGG - Intronic
1137395970 16:48116436-48116458 ACTTGGGAAAGCCTTCCTTGAGG + Intronic
1140671794 16:77286896-77286918 CCTTGGGGAAGCCATCCTTATGG - Intronic
1141301620 16:82821418-82821440 CCTTGGTGAATTCAGCCTTAGGG + Intronic
1143378542 17:6481186-6481208 CCATGGGGATGCCAGCCTTGGGG - Intronic
1143378577 17:6481335-6481357 CCTTGGGGATGCCAGCCTTGGGG - Intronic
1143378586 17:6481365-6481387 CCTTGGGAATGCCAGCCTTGGGG - Intronic
1144205510 17:12977020-12977042 CCTGGGGGAATCCATCTTCAAGG - Intronic
1148964819 17:51426048-51426070 CTTTGGGGAAGCCCTTCTCAAGG - Intergenic
1150600678 17:66648225-66648247 CCTTTGGGAAGTAATCCTTTCGG - Intronic
1154355764 18:13622273-13622295 CATTGGTGCAGCCATCCATATGG + Intronic
1155167074 18:23240185-23240207 CCTCGGGGAAGTCTTCCTTGAGG - Intronic
1157289037 18:46397069-46397091 CCCAGGGGAAGCCAACCTCACGG - Intronic
1159332470 18:67015715-67015737 CTTTGGGGAAGCCAACATTCTGG + Intergenic
1161375247 19:3936644-3936666 CCTTGAAGAAGTCATCCTGATGG - Exonic
1164822204 19:31258826-31258848 GCTTTGGGAAGCCAGCCCTAGGG - Intergenic
926116950 2:10219421-10219443 CCTTAGGGTTGCCATCCTTCAGG + Intergenic
926124854 2:10265706-10265728 TCTTGGGGAAGCCATGCGTCAGG - Intergenic
927393320 2:22621086-22621108 TCTTAGAGAAGCCATCCTTAAGG - Intergenic
930110339 2:47673578-47673600 CCTTGAAGAAGCAATACTTAAGG + Intergenic
931769671 2:65486686-65486708 CCTTGGGGCAGCCATCTGTTTGG + Intergenic
932759881 2:74432355-74432377 TCATGGGGAAGTCATCTTTAAGG + Intronic
939028718 2:137044925-137044947 CCTTGTTGAAGTCTTCCTTATGG + Intronic
939996056 2:148921046-148921068 CCTAGGAGAACCCATCCTGAGGG - Intronic
944369685 2:198967285-198967307 CCTTGTTGCAGCCATTCTTATGG - Intergenic
946736271 2:222757551-222757573 CCTTGGTGAAGCCATTCTAGAGG + Intergenic
948913895 2:241020480-241020502 CCTTGGGGAAGCTCACCTTCCGG - Intronic
1170583317 20:17715239-17715261 CCTTTGGGAATGCCTCCTTATGG + Intronic
1171013172 20:21519560-21519582 TTTTGGAGATGCCATCCTTAAGG - Intergenic
1174606671 20:51767103-51767125 ACCTGGTGAAGCCACCCTTATGG + Intronic
1174915787 20:54652498-54652520 CCCTAAGGAAGCCAGCCTTAGGG - Intergenic
1177091642 21:16776774-16776796 GCCTGGGGAAGCCATCCTAGAGG - Intergenic
1177126004 21:17193496-17193518 TCTTGGGGCAGACATCCTTCTGG - Intergenic
1177572400 21:22904041-22904063 TCTTGAGAAATCCATCCTTAGGG - Intergenic
1177633654 21:23758286-23758308 CCTCGGGGAACCCATCATTGTGG - Intergenic
1180227215 21:46401644-46401666 CCTTCGGGCAGCCCTCCTGAGGG + Exonic
1183140949 22:35938413-35938435 CCTGGGGGAATTCAGCCTTATGG - Intronic
1184848353 22:47102848-47102870 CCTTGGAGAACCCATCATTCTGG + Intronic
949169094 3:977287-977309 CCTTGGGGAAGACAACCTTCTGG - Intergenic
951675574 3:25237280-25237302 GCTTTGGGAAGCCACCCTTTGGG - Intronic
952615272 3:35263528-35263550 CCTTGGAGATGACAGCCTTATGG - Intergenic
954687482 3:52378636-52378658 CCTTGTGGAAGCCACCATCATGG + Exonic
956183898 3:66544704-66544726 CCTTGGGGAGGCGCTCCTTGGGG + Intergenic
957417968 3:79930091-79930113 CTTTGGGGAGCCCATACTTAGGG + Intergenic
958855805 3:99383737-99383759 CTTTGGGAAAGCCATCCATCTGG + Intergenic
963575643 3:147058567-147058589 CCTAGGGGCAGCCATGCTTAAGG - Intergenic
967640676 3:191859148-191859170 CCTTGGGTAAGCCTTGTTTAAGG - Intergenic
969221477 4:5761734-5761756 CCTTAGGGAAGAAAGCCTTATGG + Intronic
969328582 4:6459165-6459187 CCTCAGGCAAGCCATCCATATGG - Intronic
970948882 4:21728767-21728789 CCCTGGGGAAGCCCTTCTTAAGG + Intronic
971621796 4:28863785-28863807 CATGTGGGAAGCCACCCTTAAGG - Intergenic
971668385 4:29523409-29523431 CCTTAGGGAGCCCCTCCTTATGG + Intergenic
971804839 4:31342556-31342578 CCTTGAGGAAGCCCTCCTGTTGG + Intergenic
977388149 4:96371447-96371469 CTTTGAGAAAGCCATCATTAAGG - Intergenic
978474054 4:109105742-109105764 CCTTGGGAGAACCATCCTTAAGG - Intronic
982309289 4:153967560-153967582 CCTTTGGAAAGCCTTCCTTTAGG - Intergenic
985875117 5:2588424-2588446 CCTTGGGGAGGCCATCCCGATGG + Intergenic
987270678 5:16305155-16305177 CCTTGGGGAAGAAAGCCTAATGG + Intergenic
992268456 5:75041170-75041192 GTTTGGTGAAGCCATCCCTAAGG + Intergenic
993621207 5:90169688-90169710 CAGTGGAGAAGCCAGCCTTAGGG + Intergenic
994184158 5:96799897-96799919 GTTTGAGGAAGGCATCCTTATGG + Intronic
996628140 5:125595344-125595366 CCTTGTGAAAGCCATTGTTATGG - Intergenic
998787770 5:145730875-145730897 CCTTGGGGCAGGCATCTTTCCGG - Intronic
999357750 5:150953200-150953222 CCATGGGGTGGCCATCTTTAAGG - Intergenic
999673540 5:153977646-153977668 CCATGGTGAAGCCTTCCCTATGG - Intergenic
1001086178 5:168701557-168701579 CCTTGGGGCTGCCTTCCTCAGGG - Intronic
1007449427 6:41931765-41931787 CCTCCGGGAAGCCATCATTGTGG + Exonic
1009795312 6:68458541-68458563 CCTTGGGGAAGAAAGCCTAATGG - Intergenic
1010560550 6:77343583-77343605 CCTTGTAACAGCCATCCTTATGG + Intergenic
1014992357 6:128096904-128096926 CCTTGGGGAAGGAAAACTTAAGG + Intronic
1015441623 6:133253708-133253730 CCTCTGTGAAGCCTTCCTTAAGG + Intronic
1016435174 6:144029715-144029737 CCTTATGGAAGGCAACCTTATGG + Intronic
1022639623 7:32169784-32169806 TCTTGGTGAAGACATCCTTCAGG - Exonic
1023585291 7:41723909-41723931 CCTTAGTGAAGCCTTCCTTTAGG - Intergenic
1027160066 7:75795926-75795948 CCTGGCGGAAGCCACCCTGAAGG - Intergenic
1029173856 7:98649912-98649934 ATTTGGTGAAGCCATCCTTTGGG + Intergenic
1034268426 7:149792073-149792095 CATTGGGGCAGCCGTCCTGAGGG - Intergenic
1034542863 7:151770067-151770089 CCTTGGGGAAGGAAGCCTAATGG - Intronic
1034676682 7:152897181-152897203 CCTTGGGGGAGCCAGCCTGGAGG - Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1035033660 7:155881323-155881345 CCTTCGGGAAAGCATCATTACGG + Intergenic
1035844688 8:2850349-2850371 CCATGGGGCAGCCTTTCTTATGG + Intergenic
1036826431 8:11979841-11979863 CCAGGGGGAAGCCATCCTGAAGG + Intergenic
1038301868 8:26358542-26358564 CATTGGGAAGGGCATCCTTAGGG + Intronic
1038347220 8:26743462-26743484 CCTTGGGGAAGAAAGCCTAATGG - Intergenic
1047039474 8:120976793-120976815 TCTTGGCGAAGCCAGCCTGACGG + Intergenic
1048619134 8:136112451-136112473 ACTTGAGGAAGCCATTCTGATGG + Intergenic
1051347370 9:16164387-16164409 CGTTGGGAATGCCATCATTAAGG + Intergenic
1061180531 9:129022737-129022759 CCCTGGGGAGGCCAGCCCTAGGG + Intronic
1061373689 9:130212032-130212054 CCATGTGGAAGACATCCATATGG + Intronic
1187558113 X:20372547-20372569 CCTTGGTTCATCCATCCTTAGGG - Intergenic
1187828510 X:23357003-23357025 CCTTGAGGAAGTCACCCTTCTGG - Intronic
1189082841 X:37992656-37992678 CCTTGGGGAAGCCTGCCTACAGG - Intronic
1189526205 X:41824681-41824703 TCCAGGGGAAGCCATCCTTAGGG - Intronic
1191133127 X:57036505-57036527 CCTTGGGGTTGCCCTTCTTAAGG + Intergenic
1193537869 X:82736465-82736487 CCTTGGGTAGGACCTCCTTAAGG - Intergenic
1195258499 X:103111059-103111081 CCTTAGGGAAGCCCACCCTAAGG + Intergenic
1200000928 X:153059392-153059414 CCTTGGGGAATCCAGCCTGGAGG + Intronic