ID: 1140675108

View in Genome Browser
Species Human (GRCh38)
Location 16:77320305-77320327
Sequence CCTTCCAACTATGTTTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140675103_1140675108 22 Left 1140675103 16:77320260-77320282 CCAAATAGTAAGAACACTAGAGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1140675108 16:77320305-77320327 CCTTCCAACTATGTTTTCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140675108 Original CRISPR CCTTCCAACTATGTTTTCTG TGG Intronic
903047937 1:20578310-20578332 ACTACCAAGTAGGTTTTCTGTGG - Intergenic
904062843 1:27725190-27725212 GCTTCCTACTTTGTTTTCTCCGG - Intergenic
904535948 1:31199510-31199532 CCTTCCAGCTCTGTTGTCTGCGG - Intronic
905285640 1:36878419-36878441 CTTTCCAATTGTCTTTTCTGAGG + Intronic
906480386 1:46195715-46195737 TCTTCCCACTATGTTATATGAGG + Intronic
911067496 1:93803651-93803673 CCTGCCAACTATGCCATCTGTGG + Intronic
911994318 1:104745028-104745050 CCTTCCAATTTTGCTTTCTACGG + Intergenic
912856094 1:113169896-113169918 CCTTCCAAATCTGTCTTCTCCGG + Intergenic
914225470 1:145716431-145716453 CCTCCCAAATATGTATCCTGTGG - Intergenic
915619246 1:157069680-157069702 CTTTCCCACTGTGTTTTCAGAGG + Intergenic
916450226 1:164913619-164913641 CCATCCCACCATGCTTTCTGAGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918534785 1:185561816-185561838 ACTTACAACTGTGGTTTCTGTGG - Intergenic
1064466624 10:15589253-15589275 CATTCCCTCTATGCTTTCTGTGG + Intronic
1064469035 10:15616414-15616436 CATTCCAACGATTTATTCTGGGG - Intronic
1067934048 10:50593054-50593076 CCTTCCATCTCTGTTTTCGGAGG + Intronic
1070689803 10:78516220-78516242 CCCTCAAATTCTGTTTTCTGGGG - Intergenic
1071447909 10:85766158-85766180 CCTTCCAAGTTTCTTTTGTGAGG - Intronic
1072187687 10:93057291-93057313 CCTTAGAAATATGTTTACTGGGG + Intronic
1072535890 10:96362445-96362467 CATTCCATCTATGGTTTCTAAGG - Intergenic
1075831141 10:125412502-125412524 ATTTGCACCTATGTTTTCTGTGG + Intergenic
1077493204 11:2871636-2871658 CCTCCCCACTTTGTTTTCTGGGG + Intergenic
1077650735 11:3969742-3969764 CTTTCCAACTTTTTGTTCTGTGG - Intronic
1079725404 11:23874460-23874482 TCTTCCAAATATGTTTTTAGAGG - Intergenic
1082234202 11:49803129-49803151 TCTTCCTACTATCCTTTCTGGGG - Intergenic
1082639214 11:55635423-55635445 CCTTCAAACTTTTTTTTATGGGG + Intergenic
1086098395 11:83072642-83072664 CCTTCCAACAACGATTTCTTCGG - Intergenic
1086458119 11:86979374-86979396 CCATCCAAGTCTGTTTTCAGTGG - Intergenic
1088222664 11:107586361-107586383 CATGCCAAATATGTTTTTTGTGG + Intergenic
1088413845 11:109567559-109567581 CCTCCCAGCCATGGTTTCTGTGG + Intergenic
1088872194 11:113900365-113900387 CCTTCCAAGGATGATGTCTGGGG + Intergenic
1089201126 11:116725441-116725463 CCTTCCAACAATGTCTGCCGTGG + Intergenic
1089847453 11:121469560-121469582 TGTTCCAACTATGTTTTTTCTGG - Intronic
1089973987 11:122716814-122716836 CCTTCCAGCAAAGCTTTCTGGGG - Intronic
1090550099 11:127809824-127809846 TCTTCCAGGTGTGTTTTCTGAGG - Intergenic
1091982918 12:4881091-4881113 CATTCCAATTATTTTTTCTAAGG - Intergenic
1094215842 12:27941174-27941196 TCTTCCAGCTCTGTTTTATGTGG + Intergenic
1097851040 12:64409936-64409958 TCTTTCAACTTTGTTTTTTGTGG + Intronic
1100530519 12:95457364-95457386 CCTCCCACCTCTCTTTTCTGAGG - Intergenic
1100706107 12:97202282-97202304 TCTTCCCACTATCTTGTCTGTGG + Intergenic
1101035867 12:100705831-100705853 CCTTCCCTCTTTCTTTTCTGAGG + Intergenic
1101054080 12:100894475-100894497 CCCTCCAAACCTGTTTTCTGTGG + Intronic
1101825192 12:108214957-108214979 CATTCCAACTACTTTTACTGAGG + Intronic
1102754802 12:115329627-115329649 CCTTCCAAACATATTTTATGAGG - Intergenic
1103159445 12:118716181-118716203 TCTTCCAACTGTGTGTTGTGAGG - Intergenic
1104150669 12:126079500-126079522 CGTTCCACATATGTTTTCAGGGG + Intergenic
1104272197 12:127292764-127292786 TCATCCAACCATGTCTTCTGGGG + Intergenic
1106255432 13:28018471-28018493 GATTCCAACTATGTTGTCAGGGG - Exonic
1107347918 13:39482785-39482807 CCTTCCAACTATTCTTGCTTTGG - Intronic
1108344729 13:49534361-49534383 CCTCTCAAATATCTTTTCTGGGG - Intronic
1110261819 13:73493323-73493345 TCCTCCAACTATGCTTTCTCTGG + Intergenic
1111516096 13:89333790-89333812 CCATCCATCTCTGATTTCTGGGG - Intergenic
1111729093 13:92050820-92050842 CCTTGAAGCTATGTTTTCTTAGG - Intronic
1112467432 13:99656099-99656121 TCTTCCTGCTTTGTTTTCTGAGG + Intronic
1113271655 13:108681442-108681464 TTTGCCAAATATGTTTTCTGTGG + Intronic
1115880433 14:37911052-37911074 CCTTACATCTATGTTGTCTGAGG - Intronic
1116076506 14:40117791-40117813 CCTCCCAGCTATGATTCCTGGGG + Intergenic
1121866958 14:97371434-97371456 CATTCCAATTTTGTTCTCTGCGG - Intergenic
1122402149 14:101473868-101473890 CCTTCCAATTCTGTTCTTTGTGG + Intergenic
1122931575 14:104935257-104935279 CCTGCCAACTATGTTCTAGGAGG + Exonic
1124464337 15:29922707-29922729 CCTTTCTACTATTTTTCCTGTGG - Intronic
1124631050 15:31337379-31337401 CCTTGCAGCTGTGTGTTCTGAGG + Intronic
1125996800 15:44169473-44169495 CCTTTCAACTCTGGTTTCTTAGG - Intronic
1127000806 15:54502232-54502254 CCTTCCATACAAGTTTTCTGAGG - Intronic
1127507949 15:59612885-59612907 CCCTCCATCTCTGTGTTCTGTGG - Intronic
1127945034 15:63742985-63743007 CTTCCCAACTATATTTTGTGAGG - Intronic
1129610196 15:77047503-77047525 CCTTCCAACTACATTTTTTTTGG - Intronic
1131629447 15:94160951-94160973 CCTTCCCAGTAGGTTTGCTGGGG + Intergenic
1131796137 15:96018653-96018675 CCTGCCAACAATGTTTTCTTGGG - Intergenic
1131826851 15:96329050-96329072 GCTACCAAGGATGTTTTCTGTGG + Intronic
1134565031 16:15244131-15244153 CCTTCCCACTCTGCTTTCAGAGG + Intergenic
1134737465 16:16512565-16512587 CCTTCCCACTCTGCTTTCAGAGG - Intergenic
1134930045 16:18199593-18199615 CCTTCCCACTCTGCTTTCAGAGG + Intergenic
1135114635 16:19714402-19714424 CCTTCCCATTGTGTTCTCTGGGG + Exonic
1136577867 16:31135036-31135058 CCTTCCAACTAGATTCTCTTAGG - Intronic
1137219173 16:46429057-46429079 ACTTACATCTATGTCTTCTGCGG - Intergenic
1137552794 16:49452197-49452219 CCTACCAGCTGTGATTTCTGGGG - Intergenic
1139846914 16:69927738-69927760 CCTTCCTTCTGTGTGTTCTGAGG + Intronic
1140675108 16:77320305-77320327 CCTTCCAACTATGTTTTCTGTGG + Intronic
1140836015 16:78794467-78794489 CCTTCCATCTATGTGTCCTTAGG + Intronic
1143606291 17:7988293-7988315 CCTTCTCTGTATGTTTTCTGAGG + Intergenic
1143943849 17:10572181-10572203 CCTACCATCTATTCTTTCTGAGG + Intergenic
1144627058 17:16849405-16849427 CCCTCCAGCGATGCTTTCTGTGG + Intergenic
1144879383 17:18423307-18423329 CCCTCCAGCGATGCTTTCTGTGG - Intergenic
1144969272 17:19097241-19097263 CCTCCCAATCATGTTTTGTGTGG - Intergenic
1144978644 17:19154824-19154846 CCTCCCAATCATGTTTTGTGTGG + Intronic
1144989578 17:19223408-19223430 CCTCCCAATCATGTTTTGTGTGG - Intronic
1145152857 17:20521080-20521102 CCCTCCAGCAATGCTTTCTGTGG + Intergenic
1146199489 17:30843807-30843829 GCTGCTAATTATGTTTTCTGTGG + Intronic
1146325963 17:31886235-31886257 CCTTCCAACTGTGTTCTCTGAGG + Intronic
1147581194 17:41628090-41628112 CCCTCCAGCGATGCTTTCTGTGG + Intergenic
1148354325 17:46965389-46965411 CCTTCTGACTATGACTTCTGTGG + Intronic
1148381968 17:47206370-47206392 CCTTCCAGCTTTTTCTTCTGAGG + Intronic
1148976519 17:51534942-51534964 CCTTAAAAATATGCTTTCTGGGG - Intergenic
1149492234 17:57093304-57093326 CCTTCCACCTTTGCTTCCTGAGG + Intronic
1153815492 18:8786641-8786663 ACTTCCAACCATGGTCTCTGTGG - Intronic
1154024633 18:10696015-10696037 CCATGCAACTGTGTTTCCTGAGG - Intronic
1155355669 18:24950911-24950933 CCTTCAGAATATGTTTTCTTAGG - Intergenic
1155708408 18:28845239-28845261 CATTCCAACTCTCTTTTCTGAGG - Intergenic
1156391999 18:36659647-36659669 CCTTCCATCAGTGTTTACTGTGG - Intronic
1156845181 18:41657631-41657653 CCTTTCAACTCCATTTTCTGGGG - Intergenic
1160107021 18:75987665-75987687 CTGGCCAACTATGTTTCCTGCGG - Intergenic
1160660646 19:296840-296862 CCTTACATCTGTGATTTCTGTGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
926966084 2:18413069-18413091 CTTACCAACTATGTGTTTTGGGG - Intergenic
927327743 2:21825522-21825544 CATTCCATCAATGTTTTCTATGG - Intergenic
927381638 2:22486252-22486274 CCTTCACTTTATGTTTTCTGAGG - Intergenic
929264261 2:39900523-39900545 CCTCCTAGCCATGTTTTCTGAGG + Intergenic
929764537 2:44833189-44833211 CCCTCCAAATATGTTATCTATGG - Intergenic
930486778 2:52020186-52020208 CCTTCTAGCTACGTTTTCTTTGG + Intergenic
934569744 2:95361718-95361740 CCTCCCAGCTATGTTTCCTAGGG - Intronic
936380250 2:111978652-111978674 CCTAACATCTATGTTATCTGTGG + Intronic
940019654 2:149143619-149143641 CCTTCCAATTGTCTCTTCTGAGG + Intronic
940566204 2:155364013-155364035 CCTCCCAAGTATGTTAGCTGTGG - Intergenic
941067841 2:160923385-160923407 TCTTCCTACTCTGTTTTATGGGG - Intergenic
941105471 2:161346966-161346988 CTTTGCAGCTATTTTTTCTGTGG + Intronic
941211367 2:162644030-162644052 CCTCTTAACTATCTTTTCTGTGG + Intronic
943614835 2:190081275-190081297 GCTACCATCTATTTTTTCTGAGG + Intronic
943797005 2:192008637-192008659 CCTTCCAACTTTTTATTCTGGGG - Intronic
943890484 2:193279674-193279696 CCTTCCAACAATGATTTATTTGG + Intergenic
945647429 2:212515821-212515843 CCTTGCAAATATTTATTCTGAGG + Intronic
945810167 2:214540022-214540044 AATTCCAACTAGGTTTTCTTGGG - Intronic
947420855 2:229940506-229940528 ACTTCCAACTATCTTTTTGGGGG - Intronic
1169636436 20:7697176-7697198 CCTTCACACTCTGTTTCCTGGGG - Intergenic
1170474074 20:16697492-16697514 CCCTCCATCCAGGTTTTCTGGGG + Intergenic
1172103181 20:32498007-32498029 CCTTTCAACTTTATTATCTGGGG - Intronic
1172507131 20:35471476-35471498 ACTTGCAACTATGTTTTATTTGG - Intronic
1173123263 20:40313506-40313528 CCTTCCCACTGTGTCTTCTTGGG - Intergenic
1182817491 22:33178570-33178592 TCTTCAAACTATATTTTTTGGGG + Intronic
1184377752 22:44125162-44125184 CCCTCCAAATATACTTTCTGAGG - Intronic
1185119715 22:48958765-48958787 CCTTCCAACTTTCTTTTAAGAGG - Intergenic
949412822 3:3784321-3784343 CATTTCAACCATGTTTTCTCAGG + Intronic
953549193 3:43887502-43887524 CCTTCCTGCTATGGTTGCTGAGG + Intergenic
955080125 3:55650448-55650470 CCTTCAAACTATTTCGTCTGAGG + Intronic
956527661 3:70182428-70182450 CCTTTAAACTGTGTTTTATGGGG + Intergenic
956959809 3:74386072-74386094 CCTTCCAACTATATTATGTGGGG - Intronic
958658983 3:97041686-97041708 CCTCCCAGCTATGCTTCCTGAGG - Intronic
961338917 3:126204237-126204259 CCTCCCAGCTATGCTTCCTGTGG - Intergenic
961500769 3:127333130-127333152 ACTTCCAAATCTGTTTTATGAGG + Intergenic
961522143 3:127473037-127473059 CCATCCAACTGGGTTTTTTGAGG + Intergenic
962441112 3:135416932-135416954 TCTTCCAACTGTGTCTTCTTGGG - Intergenic
963409430 3:144908828-144908850 CCTCCCAACTCTCTTCTCTGAGG - Intergenic
963438085 3:145297907-145297929 CCTTCTAATTTTGCTTTCTGTGG - Intergenic
967526415 3:190499334-190499356 CCTTCCTCTTCTGTTTTCTGTGG + Intergenic
968018027 3:195356987-195357009 CCTCCCAACTATGTTTGAGGTGG - Intronic
969841613 4:9887087-9887109 CCTTCCATCTCTGTCTTCTTTGG + Intronic
970204802 4:13645176-13645198 CCTTCCAACCCTGTGTTCTCTGG - Intergenic
970467264 4:16337249-16337271 CCTTACAATTATATTTTCTGAGG - Intergenic
972243836 4:37223841-37223863 CCTTCCAACTAACTCTTATGAGG - Intergenic
974351737 4:60756366-60756388 ACTTCCAAATCTGTTTTATGAGG - Intergenic
974641484 4:64637317-64637339 CCATCCAAATAAGATTTCTGTGG + Intergenic
978415123 4:108466769-108466791 CTTTCCCATTATGTTCTCTGAGG + Intergenic
978828474 4:113053367-113053389 ACTTCCAACAAAGTTTTCTTAGG + Intronic
980551223 4:134337737-134337759 CCTTTCAGCTATGTTGTCTTTGG + Intergenic
981120306 4:141042776-141042798 CCTTCCGCCCATGTGTTCTGGGG + Intronic
981169014 4:141599472-141599494 ACTCCCACCTATCTTTTCTGGGG - Intergenic
983159180 4:164389451-164389473 CCTGACAAATATATTTTCTGAGG + Intergenic
986349052 5:6859918-6859940 ACTTGGAACTATCTTTTCTGGGG + Intergenic
987781526 5:22442669-22442691 CCTCTCAACTATCTTTCCTGTGG - Intronic
987959431 5:24786237-24786259 CCTTACAACTATGCTTAATGTGG - Intergenic
992545521 5:77810936-77810958 CCTCCCAACTCTCTTCTCTGAGG + Intronic
995210224 5:109529578-109529600 GCTTCCAACTATGATTTCATTGG + Intergenic
996061286 5:119036393-119036415 CTTTCCTTCTATGATTTCTGGGG - Intergenic
996331967 5:122339865-122339887 CCTTCCAAGTCTGTCTTCAGGGG + Intronic
996376003 5:122807589-122807611 CCTTTCAAAAATGTATTCTGTGG - Intronic
996561917 5:124839739-124839761 CCTTCTACCTATGTTCTTTGTGG + Intergenic
997570267 5:134921921-134921943 CCTTCCAATTATATTTTATAGGG + Intronic
998923037 5:147091723-147091745 CTTTTAAATTATGTTTTCTGTGG + Intergenic
1002390372 5:178906964-178906986 CCTTCCAGTAAAGTTTTCTGAGG + Intronic
1004051382 6:12083447-12083469 CCTGGCAACTATGTGCTCTGTGG + Intronic
1004689451 6:17980317-17980339 CCTTCCAATCATGCTTTCTTAGG + Intronic
1005317299 6:24616081-24616103 CCTACAAACAATGTCTTCTGTGG - Intronic
1005320362 6:24646793-24646815 TCTTCCACCCAAGTTTTCTGTGG - Intergenic
1005641005 6:27796216-27796238 TCTTTCATCTAGGTTTTCTGGGG + Intergenic
1008197303 6:48539730-48539752 CCATCCCACTATGTTGACTGTGG - Intergenic
1008786203 6:55171634-55171656 CCTTCTATCTATGATTTCTCTGG - Intronic
1009240482 6:61180094-61180116 GCTCCCATCTATGTTTTCAGGGG - Intergenic
1009268869 6:61592450-61592472 GCTTCCATCTATTCTTTCTGAGG - Intergenic
1009270421 6:61606699-61606721 TCTTCCAACTATTCTTTCTGAGG - Intergenic
1012277747 6:97294441-97294463 CCTTCCAATTATGTTTTTTAGGG + Intergenic
1012621701 6:101352769-101352791 ACTTCTAACTAAATTTTCTGGGG - Intergenic
1013109029 6:107050238-107050260 GCATCCAACTCTGCTTTCTGTGG + Intronic
1013460081 6:110366352-110366374 CCTTTCATCTCTGCTTTCTGTGG + Intergenic
1014565853 6:122946857-122946879 CCTTCCAGATATTTTTTCTGGGG + Intergenic
1016701104 6:147055168-147055190 CCTTTCAAATATTTTTGCTGAGG - Intergenic
1018159952 6:161029934-161029956 CCCTCAAACTAAGTTTTCTCTGG + Intronic
1019789677 7:3002938-3002960 CCTCCCAACTCTGTTTTAGGTGG - Intronic
1021192324 7:17635381-17635403 TCTTCAAAAAATGTTTTCTGAGG + Intergenic
1021432237 7:20573214-20573236 CCTTCCAACCATATTTTTTGAGG + Intergenic
1021625595 7:22589987-22590009 CCTTCCAATAATGCTTCCTGGGG + Intronic
1021953552 7:25799695-25799717 CCTTCCTAGTTTTTTTTCTGAGG + Intergenic
1026079183 7:67202109-67202131 CCTTCCAATTATGTGTTTTCTGG + Intronic
1026697640 7:72609847-72609869 CCTTCCAATTATGTGTTTTCTGG - Intronic
1026809371 7:73449625-73449647 CCTTCCACCTGTTTTGTCTGAGG - Exonic
1027815296 7:82960996-82961018 CCTTCCAGCTATGTGATCTTGGG + Intronic
1029518389 7:101043068-101043090 ACTTCCAACTAGCTTTCCTGGGG + Exonic
1030482985 7:110127715-110127737 GCTTCCAGCTTGGTTTTCTGGGG - Intergenic
1031771792 7:125852972-125852994 CATTTCAACTATATTTTATGTGG - Intergenic
1032037139 7:128529849-128529871 CCTTCCAACACTGTTCTCTTTGG + Intergenic
1032597194 7:133253353-133253375 CCCTCCACCTTTTTTTTCTGGGG + Intronic
1032635990 7:133709540-133709562 TCTTCCAGCTATGTAGTCTGAGG - Intronic
1033630420 7:143152496-143152518 CCAGCCAACAATGTTTTCTTTGG - Intergenic
1036553303 8:9834376-9834398 CATTCAAACTATGCTTTCTTGGG - Intergenic
1036762913 8:11524048-11524070 CCTTACAACAATGTTTACTGTGG + Intronic
1037406688 8:18549879-18549901 CCTTCCAACTCTGTATTTTTAGG - Intronic
1038780353 8:30564622-30564644 CCTGCCCATTGTGTTTTCTGTGG + Intronic
1041039290 8:53830199-53830221 ACTTAAAACTATGTTTTTTGGGG - Intronic
1041754736 8:61301442-61301464 CCTCCCAACCCTGTTTTCTCAGG + Intronic
1041853435 8:62420038-62420060 CTTTCCTACTATGTTTTAGGAGG + Intronic
1045655819 8:104385431-104385453 CCTTCCAACAGTGTGTTCTCAGG - Intronic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1047466277 8:125117748-125117770 CCTTTTAACTAGGTTTCCTGAGG + Intronic
1047568560 8:126073190-126073212 CCTTCCCACTGTGTTCCCTGGGG - Intergenic
1049377357 8:142295562-142295584 CCTGCCCCCTATGTGTTCTGTGG - Intronic
1050009887 9:1174510-1174532 CCTTCCAACTAAGTTTCCTCAGG - Intergenic
1050341072 9:4638991-4639013 CTTACCAACTATGTGATCTGGGG + Intronic
1052966757 9:34346201-34346223 CCTTCCAACTTTGATGTATGAGG - Intergenic
1054996277 9:71394332-71394354 TTTTCAAACTATGTTTTCTGTGG - Intronic
1057320557 9:94008878-94008900 CCTTCTGACCATGGTTTCTGAGG - Intergenic
1058266267 9:102902475-102902497 CCTTCCAATTATGTGCTATGTGG - Intergenic
1058841743 9:108916151-108916173 ACTTTCAACTACGTTTTATGGGG + Intronic
1058954489 9:109932670-109932692 CCTTCCAGTTCTGATTTCTGAGG - Intronic
1059851724 9:118348880-118348902 CCTTTCAACCATGTTGTTTGTGG + Intergenic
1060434104 9:123578636-123578658 CCTTCCATCTATCTATTCAGTGG + Intronic
1062244224 9:135555670-135555692 GCTTCAAACAATGATTTCTGAGG - Intergenic
1186450092 X:9665020-9665042 CCTTCCAACTGGTTTTTCTTGGG + Intronic
1186692663 X:11995427-11995449 CCTTCTATCTTTATTTTCTGAGG + Intergenic
1189849964 X:45168402-45168424 CCCACCAACTCTGTTTTATGTGG - Intronic
1190142076 X:47856248-47856270 TCTTTCAACTATCTCTTCTGTGG - Intronic
1191197744 X:57742819-57742841 ACTTCCAAACACGTTTTCTGGGG + Intergenic
1194845514 X:98802586-98802608 CCTTTGATCTATGTCTTCTGGGG + Intergenic
1194921259 X:99768162-99768184 ACTTCCAAAATTGTTTTCTGAGG + Intergenic
1195406550 X:104520777-104520799 CCTTCTAACTATTTTTTCATAGG + Intergenic
1196193851 X:112820314-112820336 CCTCCCACCTAAGTTATCTGTGG - Intronic
1196326282 X:114407737-114407759 ACTTCCAGATACGTTTTCTGTGG - Intergenic
1196941718 X:120783553-120783575 CCATCCAAATATGTCTTCTCAGG + Intergenic
1198319769 X:135508768-135508790 TCCTCCAACTTTGTTTTCTGAGG - Intergenic
1199590692 X:149465640-149465662 CCTTCTACCAATGTTTCCTGAGG + Intergenic
1201396514 Y:13554629-13554651 CCCACCAACTAGCTTTTCTGGGG + Intergenic