ID: 1140681641

View in Genome Browser
Species Human (GRCh38)
Location 16:77390993-77391015
Sequence TAGAGTAGATGGAAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 416}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140681641 Original CRISPR TAGAGTAGATGGAAGGATGG TGG (reversed) Intronic
900498693 1:2989126-2989148 ATGGGTAGATGGATGGATGGAGG - Intergenic
900509532 1:3051928-3051950 ATGAGTGGATGGATGGATGGAGG - Intergenic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
900993145 1:6107028-6107050 GAGGGAAGATGGAGGGATGGAGG + Intronic
900993175 1:6107147-6107169 GAGCGAAGATGGAGGGATGGAGG + Intronic
901006535 1:6174383-6174405 TATAGTGAATGGATGGATGGTGG + Intronic
901588554 1:10319053-10319075 TGGAGTAGATGGAAAAATGAAGG + Intronic
901699819 1:11039311-11039333 ATGGGTGGATGGAAGGATGGTGG + Intronic
901786123 1:11626064-11626086 TGGAGGAGATGGTGGGATGGGGG + Intergenic
901850583 1:12012402-12012424 TGTAGTAGAAGGATGGATGGTGG + Exonic
901940632 1:12658989-12659011 ATGAATAGATGGATGGATGGGGG + Intronic
902105070 1:14028256-14028278 TAGAGTTGATGGAAGGTTGATGG + Intergenic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902730965 1:18368666-18368688 AAGAGGCCATGGAAGGATGGAGG - Intronic
903140071 1:21334097-21334119 TAGATAAGATGGAGGTATGGAGG - Intronic
904154786 1:28473853-28473875 TGGTGTAGATCTAAGGATGGTGG - Exonic
904302604 1:29564560-29564582 TACAGTACTTGGAAGTATGGTGG + Intergenic
904438514 1:30514932-30514954 CTGAGTGGATGGAAGGTTGGGGG - Intergenic
904501636 1:30916095-30916117 TGGAGTAGCTGGAACTATGGTGG + Intergenic
904833123 1:33318386-33318408 GAGAGTGAATGGCAGGATGGGGG - Intronic
904847846 1:33433921-33433943 TAGGGTGAATGGCAGGATGGGGG - Intergenic
904993704 1:34614530-34614552 CTGAGTGGATGGATGGATGGTGG + Intergenic
905244873 1:36605818-36605840 TAGAGGAGTCGGAAGGAGGGAGG + Intergenic
905488981 1:38328844-38328866 CAGAGAAGAGGGAAGGATGTGGG - Intergenic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
906056645 1:42923299-42923321 CAGAGTGGATGGATGGCTGGAGG + Intergenic
906477513 1:46179801-46179823 GAGAGGAGATGGAAAGATGAAGG + Intronic
906485870 1:46234569-46234591 TAAAGTAGAAGGAAGGAGGCTGG - Intergenic
907758368 1:57333240-57333262 TAGAGGAGAAGGAAAGAGGGAGG + Intronic
908128117 1:61050412-61050434 TAGCGGAGGTGGAGGGATGGGGG + Intronic
909167865 1:72251557-72251579 TGAAGTACATGGAAGGATGAGGG - Intronic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912641095 1:111346695-111346717 TAGAGTAGAGGGCAGGTAGGGGG + Intronic
915587097 1:156849714-156849736 GAGAGTCGAGGGAAGGATGGGGG - Intronic
915695558 1:157738044-157738066 TAAAGTAGATGAAGGGTTGGTGG + Intergenic
916164468 1:161953369-161953391 TAGAGTGCCTGGAAGGTTGGTGG + Intronic
916335558 1:163667142-163667164 TACATTTGATGGAAGGATGAGGG - Intergenic
916616690 1:166448969-166448991 GAGAGGAGAGCGAAGGATGGAGG - Intergenic
919096416 1:193042517-193042539 TAGATTAGATGTGAGGACGGAGG - Intronic
919111232 1:193221184-193221206 AAGAGAAGATTGGAGGATGGGGG + Intronic
920822483 1:209393975-209393997 TAGAGCAGCTGGAATGATTGGGG + Intergenic
921274205 1:213501947-213501969 AACAGGAAATGGAAGGATGGAGG - Intergenic
922790898 1:228310413-228310435 AATAGTAAATGGATGGATGGTGG - Intronic
922893109 1:229076840-229076862 TGAAGTAGCTGGGAGGATGGAGG + Intergenic
922957843 1:229619603-229619625 TAGCGTAGGTGGAAGGCTGTAGG - Intronic
1063230324 10:4060083-4060105 TAGGGTTGGTGGAAGGAGGGTGG - Intergenic
1063597986 10:7454596-7454618 AAGAGTGGAGGGCAGGATGGGGG + Intergenic
1064300345 10:14117657-14117679 GAGAGAAGGTGGAAGGAGGGTGG + Intronic
1068124709 10:52825317-52825339 TAAAGTATGTGGAAGGATGTGGG + Intergenic
1069463835 10:68620317-68620339 TGGGGTAAATGGAAGGATTGGGG - Intronic
1069603571 10:69725429-69725451 TGGATTGGATGGATGGATGGAGG - Intergenic
1069911140 10:71760666-71760688 CAGAGCAGATGGAAGGAGAGTGG + Intronic
1070374796 10:75819158-75819180 TTTAGTAGATGGGAGGAGGGAGG - Intronic
1070421133 10:76238473-76238495 TAGAGAAGATGGGAGGGCGGGGG - Intronic
1070975825 10:80604734-80604756 TGGAGTAGATGGAGGGAGAGAGG - Intronic
1071596644 10:86932664-86932686 TGGAGGGGATGGAAGGAGGGTGG + Exonic
1072532787 10:96335379-96335401 TTGAGTGAATGAAAGGATGGAGG - Intronic
1072567423 10:96628620-96628642 TTGAGTAGGTGGATGGATGGAGG - Intronic
1073291562 10:102415860-102415882 TAGCGCAGATGGAAAGATTGAGG + Intronic
1073559710 10:104486467-104486489 CAGGGTAGATGGAAGGACAGGGG + Intergenic
1074114604 10:110446277-110446299 TAGAGGGGATGGAAGGCTGGAGG - Intergenic
1075529396 10:123215251-123215273 TAGAGTTGGTGGAAGGTTGTGGG - Intergenic
1076096864 10:127739328-127739350 TAGAGCAGATGGGAAGAAGGTGG + Exonic
1077283168 11:1754521-1754543 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283178 11:1754546-1754568 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283211 11:1754675-1754697 TGGAGGAAATGGAGGGATGGAGG + Intronic
1077463542 11:2722790-2722812 TGGGGTAGAGGGAAGGAGGGAGG - Intronic
1077490887 11:2860462-2860484 TAGAGGAGATGGAAGCACAGAGG - Intergenic
1077883203 11:6367055-6367077 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1079329849 11:19524203-19524225 TTGAGTAGATGGATGACTGGAGG + Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079772835 11:24485308-24485330 TAGGGTAGTGGGAAGGTTGGTGG - Intergenic
1080564733 11:33497596-33497618 TAGTATATCTGGAAGGATGGAGG + Intergenic
1081626469 11:44658950-44658972 GAGATGAGATGGAAGGAGGGAGG + Intergenic
1082038725 11:47667251-47667273 AGGAGTAGATGGATGGCTGGGGG - Intronic
1083139120 11:60707135-60707157 TATAGTAGGTGCAAGGCTGGGGG - Intronic
1084785710 11:71440584-71440606 GAGGGTAGATGGATGGATGATGG + Intronic
1085907749 11:80785008-80785030 TACAATAGATGGCAGGGTGGTGG - Intergenic
1087557464 11:99739590-99739612 TAGAGAAGATGGAAAGGTGGAGG + Intronic
1088438394 11:109841148-109841170 AAGAGAAGAAGGAAGGAAGGAGG + Intergenic
1088700811 11:112409596-112409618 AAGAGTAGCTGGAAGGAAGATGG - Intergenic
1089557713 11:119323770-119323792 CAGAGCAGGTGGGAGGATGGGGG + Intergenic
1090186367 11:124741643-124741665 TAGAGAAGATAAATGGATGGTGG + Intronic
1091057005 11:132429013-132429035 TTGACTAGATGAATGGATGGAGG + Intronic
1091375509 12:22488-22510 CAGGGGAGAAGGAAGGATGGAGG + Intergenic
1092217586 12:6693997-6694019 GAGAGTGGAAGGAAGGAGGGAGG + Exonic
1092234170 12:6795798-6795820 GAGATGAGATGGAAGGGTGGGGG - Intronic
1093082736 12:14831883-14831905 TAGAGTAACTGAAAGGATGGAGG - Intronic
1094559898 12:31542363-31542385 AAGGGTAGAAGGTAGGATGGGGG + Intronic
1095512645 12:42969812-42969834 TAGAGTATGTGGCAGCATGGTGG - Intergenic
1096409953 12:51369738-51369760 TAGAGCAGCTGGAGGGATGCTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097100826 12:56587955-56587977 AATAGTACCTGGAAGGATGGAGG + Intronic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097884998 12:64720184-64720206 TAGAGGACATGAAAGAATGGAGG + Intronic
1098578013 12:72066473-72066495 TAGGGTAGATGGGTGGAAGGCGG + Intronic
1098881542 12:75922265-75922287 GAGAGGAAATGGAAGAATGGTGG - Intergenic
1099059140 12:77884196-77884218 TAGAATTGATGGATGGACGGAGG + Intronic
1099242213 12:80151694-80151716 TAGAACAGAGGGAATGATGGTGG + Intergenic
1100744973 12:97635648-97635670 ATGAATAGATGGAAGAATGGAGG - Intergenic
1101199033 12:102415611-102415633 GAGAGAAGAAGGAAGGAAGGAGG - Intronic
1102920820 12:116789929-116789951 GAGAGTGGATGGATGGATGGTGG + Intronic
1102988423 12:117297376-117297398 TTGGGTAAGTGGAAGGATGGTGG + Intronic
1103099210 12:118157681-118157703 TGGAGTTTATGGAAGCATGGAGG - Intronic
1103162421 12:118740459-118740481 GATAGAGGATGGAAGGATGGAGG + Intergenic
1103164246 12:118756666-118756688 TGGAGAAGATGGATGGATGATGG - Intergenic
1104300940 12:127564584-127564606 AGAAGTAGATGAAAGGATGGGGG - Intergenic
1106630941 13:31472382-31472404 GAGAGGAGATGCAAGGATAGAGG - Intergenic
1107584990 13:41836287-41836309 GAGAGGAGATGGCAGGATGAAGG + Intronic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1109318624 13:60782174-60782196 TCCAGTAGATGAAAGGATGTTGG + Intergenic
1109342860 13:61084092-61084114 CAGAGTAGAAGGAAGAGTGGGGG + Intergenic
1111694654 13:91608139-91608161 TAGGGTAGATGGGAATATGGTGG + Intronic
1112049185 13:95628850-95628872 GAAAGTAGCTGGAAGGAGGGGGG + Intronic
1112947014 13:104941479-104941501 AAGAAAAGAGGGAAGGATGGAGG + Intergenic
1114678592 14:24462953-24462975 TTGAGTAAATGAAAGAATGGTGG + Intergenic
1115171037 14:30507381-30507403 CAGAGAAGCTGGAAGGATTGAGG - Intergenic
1116872946 14:50084932-50084954 GAAAGGAGATGGAGGGATGGAGG + Intronic
1117363259 14:54998727-54998749 TAGTGTACATGCAAGCATGGCGG - Intronic
1119206615 14:72799175-72799197 ATGGGTTGATGGAAGGATGGAGG - Intronic
1120635179 14:86942215-86942237 AGGAATAGATGGAAGGAGGGAGG + Intergenic
1120807577 14:88769307-88769329 TAGAGTAGAAGGAAGCGAGGTGG - Intronic
1122011545 14:98753116-98753138 GTGAGTGGATGGATGGATGGAGG + Intergenic
1122320712 14:100853954-100853976 ATGAGTGGATGGAAGAATGGAGG + Intergenic
1122612250 14:102993524-102993546 ATGAGAGGATGGAAGGATGGAGG + Intronic
1124238912 15:28014026-28014048 TTGAGGAGATGGCAGGCTGGAGG - Intronic
1125131655 15:36290084-36290106 GGGAGTAGAAGGAAGAATGGAGG + Intergenic
1125331891 15:38590584-38590606 CAGAGAAGATGGAAGGAGAGAGG - Intergenic
1127331267 15:57942488-57942510 TACATTAGAAGGATGGATGGAGG - Intergenic
1127857095 15:62961927-62961949 GTCAGTGGATGGAAGGATGGAGG - Intergenic
1128614046 15:69095582-69095604 TAGGGAAGGTGGAAGGAGGGAGG - Intergenic
1128793684 15:70450134-70450156 ATGAGTGGATAGAAGGATGGAGG + Intergenic
1129501919 15:76047621-76047643 TAGAGGAGAGGGAAGGATAAAGG + Intronic
1129832747 15:78681426-78681448 TACAGCAGAGGGAGGGATGGAGG - Intronic
1129933058 15:79428287-79428309 GAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1130136346 15:81184819-81184841 TAAAGTGGATGGAAGGGTGTTGG + Intronic
1131132368 15:89908488-89908510 TAGGGTAGATGTGAGGTTGGCGG - Intronic
1131164451 15:90132225-90132247 TAAAGTATATGGGAGGATGTGGG - Intergenic
1131756317 15:95566695-95566717 GTGAGTAGAAGGAAGGAAGGTGG - Intergenic
1131804109 15:96103990-96104012 TACAGTTGAGGGAAGGATTGTGG - Intergenic
1132070421 15:98771878-98771900 TGGAGAAGAAGGAAGGAGGGAGG - Intronic
1132894289 16:2220693-2220715 TTGAGCAGAGGGAATGATGGTGG - Intergenic
1133191316 16:4135662-4135684 TAGAGGATAGGGATGGATGGAGG + Intergenic
1133629209 16:7603184-7603206 TAGAGTCTATGGAAGGAAGCAGG + Intronic
1133770993 16:8867210-8867232 GAGAATGGAGGGAAGGATGGAGG - Intronic
1133898244 16:9949492-9949514 TAGGGTAGATGGATGGATGACGG + Intronic
1134105971 16:11486251-11486273 GTGAATAGATGGATGGATGGAGG + Intronic
1134325492 16:13203875-13203897 AATAGTAGATGGATGGATGATGG - Intronic
1134456843 16:14401210-14401232 TTGGATAGATGGAAGGATAGAGG + Intergenic
1134746647 16:16593866-16593888 GAGAGTAGGTGGATGGATGGAGG - Intergenic
1134998829 16:18759814-18759836 GAGAGTAGGTGGATGGATGGAGG + Intergenic
1135005385 16:18817495-18817517 AAGAGGAGATGGGAGGAAGGTGG + Intronic
1135614740 16:23901493-23901515 GAGAGTAGATGGATAGATGAGGG + Intronic
1136474698 16:30505481-30505503 CAGAGTGGATGGGAGGCTGGAGG - Intronic
1136622645 16:31440276-31440298 TAGAGGAGATGAAATTATGGAGG - Intronic
1137664219 16:50239532-50239554 GAAAGTAGAAGGAGGGATGGGGG - Intergenic
1137699201 16:50484297-50484319 AAGACTAGATGGAAGACTGGAGG + Intergenic
1137905001 16:52312112-52312134 TAGATTAGATAGATGGATGATGG + Intergenic
1138087155 16:54143584-54143606 TAAAGAAGAAGGAAGGAAGGAGG + Intergenic
1138495712 16:57408002-57408024 ATGGGTAGATGGATGGATGGAGG - Intronic
1139829463 16:69785261-69785283 TAGAGATGATGGAAGGAGGGAGG + Intronic
1139923063 16:70471558-70471580 CAGAGCAGATGCAAGGAGGGAGG - Intronic
1140678922 16:77364630-77364652 ATGAGTGGATGGATGGATGGTGG + Intronic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1141110102 16:81265317-81265339 GTGGGTAGATGGATGGATGGAGG - Intronic
1141331280 16:83113699-83113721 GAGAGTAGAAGGATGGGTGGGGG + Intronic
1141421621 16:83921397-83921419 GAGGGTGGATGGAAGGAAGGAGG + Exonic
1141714888 16:85721158-85721180 ATGAGTAGATTGAAGGCTGGAGG - Intronic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1144252492 17:13431826-13431848 TAAAGTATATGGGAGGATGTGGG - Intergenic
1144471402 17:15545360-15545382 GACAGTAGTTGGAATGATGGGGG - Intronic
1144925068 17:18799333-18799355 GACAGTAGTTGGAATGATGGGGG + Intronic
1145785314 17:27589740-27589762 TAGATTTGAAGGAAGGATGGGGG - Intronic
1146593835 17:34152837-34152859 TAGAGTGGAAGGAAGGAGGAGGG - Intronic
1147142614 17:38467881-38467903 TTGAGTCGATGGAGGGATGGAGG - Intronic
1147207858 17:38851555-38851577 TAGATGAGATGGCAGGAGGGTGG - Intronic
1147250114 17:39148107-39148129 TAGAGAAGATGGTGGGATGAGGG + Intronic
1147862807 17:43533441-43533463 TACAGGAGAAGGAAGGATAGAGG + Intronic
1148161050 17:45450277-45450299 TAGATTAGATAGATGGATGGTGG - Intronic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1149090457 17:52772119-52772141 GAGAGTAGATGGAGGGAGGAAGG + Intergenic
1149538499 17:57451068-57451090 TTGAGTAGATGGATAGTTGGAGG + Intronic
1150634541 17:66903799-66903821 TAGGGTGGATAGATGGATGGTGG + Intergenic
1150772004 17:68050250-68050272 AAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1150772025 17:68050361-68050383 AAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1151345736 17:73500251-73500273 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151345743 17:73500281-73500303 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151429424 17:74052473-74052495 TTTAGGAGATGGAAGGAGGGAGG + Intergenic
1152038904 17:77890741-77890763 GAGAGTGGATGGGAGGGTGGGGG - Intergenic
1153459579 18:5318807-5318829 TAGACTGGGTGGTAGGATGGAGG - Intergenic
1155302780 18:24447143-24447165 TTGAGTGGATGGATGGATGAAGG + Intronic
1155984199 18:32212598-32212620 AAGAGTAGATTGCAGGATGTAGG + Intronic
1156446255 18:37239314-37239336 CAGAGGAGATGGAAGGATTAGGG - Intergenic
1157099983 18:44720650-44720672 GAGAGTACAGGGAGGGATGGAGG + Intronic
1157652957 18:49355010-49355032 CAGAGTAGATCAAAGGATGATGG - Intronic
1157652961 18:49355121-49355143 CAGAGTAGATCAAAGGATGATGG - Intronic
1158060385 18:53333573-53333595 TAGAGTAGATGGCTGGAGTGAGG + Intronic
1158692339 18:59671783-59671805 CAGATTAGATAAAAGGATGGTGG + Intronic
1159918838 18:74209403-74209425 TAGAGCAGAAGGAGGGAAGGAGG - Intergenic
1160637416 19:89529-89551 TGGAGGAGATGGAAGGTTGAAGG - Intergenic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161449133 19:4334870-4334892 ATGAGTAGGTGGATGGATGGAGG - Intronic
1162829210 19:13274076-13274098 TTGAGGAGAGGGAAGGATGTGGG + Intronic
1163347627 19:16753806-16753828 TAGAGATGATGGAGGGAGGGAGG - Intronic
1163347648 19:16753934-16753956 GAGAATGGATGGAAGGATGGAGG - Intronic
1163382656 19:16979048-16979070 AAGAATAGATGGATGGATAGTGG - Intronic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1163491221 19:17618169-17618191 TGGGGTAGAGGGAAGGATGTGGG - Intronic
1163609885 19:18295318-18295340 GTGGGTAGATGGATGGATGGTGG - Intergenic
1163609890 19:18295337-18295359 GTGGGTAGATGGATGGATGGTGG - Intergenic
1163811647 19:19436326-19436348 TAGAGAAGATGGAGGGAGGCAGG + Intronic
1164700316 19:30280159-30280181 AAGTGCAGATGGAAGGATGGAGG - Intronic
1164729759 19:30494583-30494605 TAGGTTAGATGGAAGGAAGGAGG - Intronic
1164732029 19:30513686-30513708 TAGAGTTGAAGGGTGGATGGAGG + Intronic
1164937082 19:32223392-32223414 GAGGGTAGAAGGAAGGATAGAGG + Intergenic
1165313780 19:35042708-35042730 TAGGGTAGAAGGGAGGCTGGTGG - Intronic
1167144069 19:47671772-47671794 GCAAGTAGATGGAAGGATGGAGG + Intronic
1167387540 19:49172697-49172719 GTGAGAAGATGGATGGATGGAGG - Intronic
1167387610 19:49173241-49173263 GTGAGAAGATGGATGGATGGAGG - Intronic
1167387621 19:49173315-49173337 GTGAGAAGATGGATGGATGGAGG - Intronic
1167724296 19:51200247-51200269 GAGGGGAGAGGGAAGGATGGGGG - Intergenic
1168135580 19:54349184-54349206 GAGGGTGGATGGATGGATGGAGG + Intergenic
1168465545 19:56598329-56598351 TAGAGGAGATGGAAGGGGAGAGG + Intronic
925030174 2:644263-644285 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925030180 2:644340-644362 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925030184 2:644379-644401 TAGAGTAAATGAAGGGATGGAGG + Intergenic
925030194 2:644457-644479 TAGAGTAAATGAAGGGATGGAGG + Intergenic
925118553 2:1399968-1399990 TGGAGAAGAGGGAAGGGTGGCGG - Intronic
925965898 2:9065665-9065687 CAGAGTTGAGGGAAGAATGGTGG - Intergenic
926038311 2:9652471-9652493 TTGGGTGGATGGATGGATGGGGG - Intergenic
926663768 2:15497440-15497462 TAGATTAGATGGGGGGATGAAGG + Intronic
926760923 2:16278407-16278429 TTGAGGAGAAGGGAGGATGGAGG - Intergenic
927962942 2:27251855-27251877 TCGAGGAGAGGGAAGGAGGGTGG - Intergenic
929294068 2:40226590-40226612 TAGAGTGGAGGGAAGCAAGGTGG - Intronic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930178711 2:48328374-48328396 TACAGTATATGGAAGGAAGTGGG - Intronic
930907427 2:56588869-56588891 AAGAATGGATGGATGGATGGTGG + Intergenic
932030083 2:68174553-68174575 TAAAGTATATGGGAGGATGTGGG + Intronic
932329990 2:70893046-70893068 TTGAGGAGATAGAAGGCTGGGGG + Intergenic
932486843 2:72089309-72089331 GAGAGTGGAAGGAAGGAGGGAGG + Intergenic
933227921 2:79772413-79772435 TAGAGAAGATGGCAAGATAGTGG + Intronic
934658323 2:96129507-96129529 TGGAGTAGATGGGACAATGGTGG + Intronic
936835391 2:116703594-116703616 GTGAGTAGAGGGAAGGGTGGAGG - Intergenic
938192422 2:129295869-129295891 TAAAGTAGAAGGAATGAAGGTGG - Intergenic
938977571 2:136494542-136494564 CAGAGAAGAGGGATGGATGGGGG + Intergenic
939299738 2:140320073-140320095 TAGATTAAATGGAAGGAGGGAGG - Intronic
939308398 2:140438806-140438828 TAGATTAGATGAAAGGATGCAGG + Intronic
939875025 2:147568215-147568237 ATGAGTATATGGAGGGATGGAGG + Intergenic
941568017 2:167132670-167132692 TAGAGTAGGTGGGAGCAGGGAGG - Intronic
943197275 2:184770071-184770093 TTGAGTAGATGGTAGAATGTAGG - Intronic
945700142 2:213159536-213159558 TAAAGCAGGTAGAAGGATGGTGG - Intergenic
946035841 2:216741427-216741449 TAGAGTAGATGGTAGGATTTAGG + Intergenic
946044535 2:216810402-216810424 CAGGGAAGCTGGAAGGATGGTGG + Intergenic
946049310 2:216848813-216848835 TTGAATAGATGGACAGATGGAGG - Intergenic
947331670 2:229035451-229035473 GTGAGTAGAGGGAAGGAGGGGGG - Intronic
947610272 2:231520977-231520999 TAGGGTAGATGAACTGATGGTGG + Intergenic
947812913 2:233015417-233015439 ATGAGTGGATGGATGGATGGTGG - Intronic
947812933 2:233015500-233015522 ATGAGTGGATGGATGGATGGTGG - Intronic
947838090 2:233189495-233189517 TAGAGGAGAAGGCAGGCTGGCGG - Intronic
1169515136 20:6308645-6308667 TAGAGTAGAAAGTAGAATGGTGG - Intergenic
1169732968 20:8806462-8806484 TAGAGGAGATGAGAGGAAGGAGG - Intronic
1170023437 20:11862682-11862704 TAGTGAATATGCAAGGATGGAGG - Intergenic
1170998811 20:21393178-21393200 TTTTGTATATGGAAGGATGGGGG - Intergenic
1172628165 20:36360619-36360641 ATGAGTAGCTGGAAGGGTGGGGG + Intronic
1172956406 20:38762652-38762674 TAGAGTTGGTGGAGGGATGACGG + Intronic
1173918043 20:46724503-46724525 TGAAGTAGATGAATGGATGGAGG + Intronic
1174306977 20:49619992-49620014 TGGGATAGATGGATGGATGGGGG + Intergenic
1174513749 20:51075476-51075498 AAGAGTAGGGGGAAAGATGGGGG - Intergenic
1175078171 20:56393267-56393289 TAAGGTACCTGGAAGGATGGAGG - Intronic
1175890256 20:62312834-62312856 GAGAGGAGATGGAACGATGGGGG - Intronic
1175983945 20:62755065-62755087 AAGGATAGATGGAAGGATGGAGG - Intronic
1176018609 20:62951674-62951696 TAGGGTAGGTGAAAAGATGGTGG - Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1178342082 21:31794220-31794242 TTGAGTGGAGAGAAGGATGGCGG + Intergenic
1178357898 21:31923710-31923732 AAGAACAGAAGGAAGGATGGAGG - Intronic
1178878072 21:36427897-36427919 TAGAGTAGAAGGGAAGATGAGGG + Intergenic
1178985723 21:37301166-37301188 TGGAGTAGATGGAAAGAAGGGGG - Intergenic
1182094610 22:27617614-27617636 TAGAGAAGATTGAAGGAGAGGGG + Intergenic
1182680729 22:32077416-32077438 GAGAGTAGGGGGAAGGATGGAGG - Intronic
1182725641 22:32443098-32443120 TAGAGGAGATGGCAAGCTGGCGG - Intronic
1183082125 22:35463338-35463360 GTGGGTAGATGGATGGATGGTGG - Intergenic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183509578 22:38227036-38227058 TGGAGGGGATGGAAGGATAGAGG + Intronic
1183602640 22:38849021-38849043 TAGAGGAGAGGGAAGGATGGAGG - Intergenic
1184262019 22:43323322-43323344 GTGAGTAGATGGATGGATAGTGG - Intronic
1184292995 22:43508327-43508349 ATGGATAGATGGAAGGATGGGGG - Intergenic
1184666764 22:45993392-45993414 TGGAGGTGATGGAATGATGGTGG + Intergenic
1184666793 22:45993547-45993569 TGGAGGTGATGGAATGATGGTGG + Intergenic
1184731229 22:46372201-46372223 GTGAGTAGATGGATGGTTGGAGG - Intronic
1184731246 22:46372278-46372300 GCGAGTGGATGGATGGATGGGGG - Intronic
1184731288 22:46372436-46372458 GTGAGTGGATGGATGGATGGGGG - Intronic
1184731304 22:46372486-46372508 GTGAGTGGATGGATGGATGGGGG - Intronic
1184888819 22:47367237-47367259 AAGAGTACAGGGAAGGATGAAGG - Intergenic
1185011369 22:48316473-48316495 TTGAAGAGCTGGAAGGATGGAGG + Intergenic
949802387 3:7917849-7917871 TGAAGTAGATGGAAAGATGGGGG - Intergenic
952761442 3:36917962-36917984 TAGAGGAAATTGAGGGATGGAGG + Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
954225523 3:49178400-49178422 CAGAGCAGATGGTAGGGTGGAGG - Intronic
955222802 3:57037196-57037218 AAGAAAAGATGGAAGGGTGGTGG + Intronic
955313999 3:57920018-57920040 CAGACTAGATGTAAGAATGGTGG + Intronic
955972120 3:64445806-64445828 GAGTGGAGATGGAAGGATGAGGG + Intergenic
956885931 3:73559741-73559763 GATAGTAGAAGGATGGATGGTGG + Intronic
957649413 3:82980821-82980843 TAGAGTAGATTGAGGGGTGAAGG + Intergenic
958701977 3:97603342-97603364 TAGAGTAAATGGAAGGTGTGAGG - Intronic
958973813 3:100642672-100642694 TAGATTAGATGGAAGGTGGGAGG - Intronic
959296973 3:104548118-104548140 TTGATTAGATGGGGGGATGGAGG - Intergenic
961055815 3:123787951-123787973 TACAGCAGATGGAAGAAGGGAGG + Intronic
961673823 3:128552910-128552932 TGGAGCAGCAGGAAGGATGGGGG + Intergenic
962962699 3:140325724-140325746 TAGAGGAGAAGAAAGGAAGGAGG - Intronic
963752085 3:149191342-149191364 TAGTGTATATGGGAGGAAGGAGG - Intronic
964109775 3:153076294-153076316 TAGAGTAAATTGAACGGTGGAGG - Intergenic
965735327 3:171813590-171813612 TAGGGTAAATGGAATGGTGGTGG - Intergenic
967311698 3:188112209-188112231 CTGAGTAGATGAAAGGATGAAGG - Intergenic
968594669 4:1476243-1476265 ATGGGTAGATGGATGGATGGTGG + Intergenic
968756325 4:2418139-2418161 TGGAGTGGAGGGAAGGATGTCGG + Intronic
969631697 4:8342848-8342870 TAGATTAGAGGGAAGCATGGAGG + Intergenic
970828470 4:20307074-20307096 TAGAGCGGGTGGAGGGATGGAGG - Intronic
970978686 4:22071996-22072018 GAGAGTTGATGGCAAGATGGAGG - Intergenic
971069648 4:23077033-23077055 CAGAGTAGATGGATAGATGATGG + Intergenic
971788642 4:31138208-31138230 CAGGGTAGATGGATGGGTGGTGG - Intronic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
973015440 4:45131743-45131765 TGGAGTAGATGAGAGGAAGGAGG - Intergenic
974439468 4:61898177-61898199 TAGGGCAGAAGGCAGGATGGAGG + Intronic
975074249 4:70185142-70185164 TGGAGTAGAAGGAAGGGTTGTGG + Intergenic
976909268 4:90280376-90280398 AACAGGAGATGGAAGGAGGGAGG - Intronic
978028889 4:103913768-103913790 TAGAGTATTTTGAAGCATGGTGG - Intergenic
983928890 4:173432202-173432224 TAAAGTAGATAGAAAGAGGGAGG - Intergenic
986315573 5:6584320-6584342 TAGACTAGAGGGAAGGACCGAGG + Intergenic
986589661 5:9355395-9355417 TAGAGAAGATGGAGGAAAGGAGG + Intronic
986830931 5:11577444-11577466 TAGAAAAGATGGAAGGGTGTGGG + Intronic
987642585 5:20631620-20631642 AAGAGAAGAAGGAAGGAGGGAGG + Intergenic
988073979 5:26327951-26327973 GAGAGTAGAATGAAGAATGGAGG - Intergenic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988439013 5:31210687-31210709 TAAAGTATATGGGAGGATGTAGG - Intronic
988452008 5:31352675-31352697 AGGAGTAGAGGGAAGGAAGGAGG - Intergenic
990822433 5:59857858-59857880 GAGAGCAGAAGGAAGGAAGGTGG + Intronic
992746343 5:79824808-79824830 TAGAGAAGATAGATGGAGGGAGG + Intergenic
993280739 5:85921424-85921446 ATGAGTAGATGGAATGGTGGAGG - Intergenic
994076798 5:95660796-95660818 TAGAGAAGATGGTAGGATGTAGG - Intronic
994648171 5:102495744-102495766 TAAATCAGAAGGAAGGATGGAGG + Intronic
995838535 5:116421802-116421824 TAGAGCAGAAGGAGGGAAGGGGG + Intergenic
996841769 5:127854134-127854156 GAGAATGAATGGAAGGATGGGGG - Intergenic
997206507 5:132053485-132053507 TAGAGAAGGTGGAAGGGTCGTGG + Intergenic
997253249 5:132407620-132407642 AAGAGAAGAGGGAAGGATGGAGG + Intergenic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
998452759 5:142247361-142247383 AAGAAAAGATGGAAGGAAGGAGG - Intergenic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
1000334048 5:160228881-160228903 TAGAGAAGCAGGAAGGTTGGAGG - Intronic
1000397262 5:160788838-160788860 ATGAGTGGATGGATGGATGGTGG - Intronic
1000694200 5:164359645-164359667 GAGTGTAGATGAATGGATGGAGG - Intergenic
1000982602 5:167832577-167832599 AAGTGTGGATGGATGGATGGAGG + Intronic
1001017535 5:168154840-168154862 TTGTGTAGATGCAAGTATGGGGG - Intronic
1001080936 5:168666830-168666852 TAAAATAGATGGGTGGATGGAGG - Intronic
1001164682 5:169353023-169353045 AAGAGGAGAAGGAAGGATAGAGG - Intergenic
1001530793 5:172460086-172460108 GAGAGAAGATGGAATGAAGGAGG - Intergenic
1001802928 5:174559022-174559044 TGGAGTGGAAGGAAGGAAGGAGG - Intergenic
1003973170 6:11318346-11318368 TAGAAAAGAAGGAAGGAAGGAGG + Intronic
1004055911 6:12138839-12138861 CCAAGCAGATGGAAGGATGGCGG - Intronic
1006057910 6:31399622-31399644 GAGAAAAGAGGGAAGGATGGGGG - Intergenic
1006202755 6:32311338-32311360 TAGAGTATATGCTTGGATGGGGG + Intronic
1006339654 6:33439890-33439912 TAGAGTAGAGGGATGTATGTTGG + Intronic
1006557872 6:34884418-34884440 AAGGGTATATGGAAGGATGAAGG + Intronic
1007016050 6:38468048-38468070 TAGATTAGAATGAAGGATAGAGG - Intronic
1007167247 6:39837378-39837400 TAGAGCTGTTGGAAGGATGTGGG - Intronic
1008620472 6:53266464-53266486 TGAAGTAGATGGAAGGAAGATGG + Intergenic
1008722048 6:54366581-54366603 TAGAGAAGAGGGAGGGAGGGAGG + Intronic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1010127883 6:72455260-72455282 TAGAATAGCTAGAAGCATGGTGG + Intergenic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1012666342 6:101975848-101975870 TTGAATGGATGGATGGATGGAGG - Intronic
1013276295 6:108587944-108587966 TAGAGGAGGAGGGAGGATGGGGG - Intronic
1013316296 6:108946296-108946318 TAGAACAGATAGATGGATGGAGG + Intronic
1013891560 6:115033166-115033188 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1014877715 6:126681638-126681660 TAGAGGAGATGGCAGGTGGGTGG + Intergenic
1016017403 6:139200176-139200198 TAGAAGAGAGGGAAGGAAGGTGG - Intergenic
1016068653 6:139710711-139710733 TGGAGTAGAAGCAAGGAAGGGGG + Intergenic
1016271474 6:142295206-142295228 TTGAGCAGCTGCAAGGATGGTGG - Intergenic
1017350245 6:153432500-153432522 TGGAGTAGATGGAAGAGAGGGGG - Intergenic
1017538932 6:155379952-155379974 TAGAATAGCTGGAGAGATGGTGG + Intergenic
1017591061 6:155978431-155978453 CTGAGTAGATGGATGGATGTTGG + Intergenic
1018361010 6:163068063-163068085 TGGAGCAAATGGATGGATGGAGG - Intronic
1018987693 6:168650018-168650040 TGGTGTTGAGGGAAGGATGGAGG + Intronic
1019326889 7:442901-442923 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326903 7:442969-442991 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326922 7:443064-443086 ATGAATAGATGGATGGATGGTGG + Intergenic
1019489552 7:1305837-1305859 TTGGGTAGATGGATGGATGGTGG - Intergenic
1021584104 7:22189479-22189501 TAGAGGAGTTGAAGGGATGGGGG - Intronic
1022410910 7:30137547-30137569 TAGAATAGATAGAAAGATAGAGG + Intronic
1022500372 7:30878803-30878825 TTGAGTAAATGGGTGGATGGTGG - Intronic
1022536529 7:31102006-31102028 GAGAGGAGAAGGAAGGAAGGAGG - Intronic
1023163261 7:37318754-37318776 TGGGGTAGATGGAAGAATGGAGG - Intronic
1023457142 7:40352453-40352475 GAGAGTAGAGGGAAGGAGGAGGG - Intronic
1024935678 7:54709706-54709728 TAAAATAGTTGGATGGATGGGGG - Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1027488180 7:78787769-78787791 TATAGAAGATGAAAGAATGGCGG + Intronic
1029906226 7:104095969-104095991 TAGTGTAGCTGAGAGGATGGGGG - Intergenic
1031663103 7:124451863-124451885 TACAGTAGAGGGAGGGAGGGAGG + Intergenic
1033015772 7:137669990-137670012 TTGAGTGGATGGGAGGATTGTGG - Intronic
1034237305 7:149582407-149582429 TAGAGTAGCTGGAGGGCTGGCGG - Intergenic
1034240327 7:149605843-149605865 CAGAGTAGCTGGAGGGCTGGCGG - Intergenic
1034243913 7:149630289-149630311 TAGAGTAGCTGGAGGGCTGGCGG - Intergenic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035459783 7:159031604-159031626 TAGGGTGGACGGAAGGACGGCGG + Intronic
1035903299 8:3480861-3480883 AAGAGTAGGTGGTAGGCTGGGGG + Intronic
1036200949 8:6771286-6771308 TAGAGTGGATGGATGGGTGCTGG + Intergenic
1036465602 8:8994128-8994150 GAAAGGAGATGGAAGGTTGGAGG + Intergenic
1036761992 8:11515588-11515610 TAAAGAAAATGGAAGGAAGGGGG - Intronic
1037842531 8:22255593-22255615 TAGACTCGTTGGAAGGCTGGAGG + Intergenic
1038036049 8:23687926-23687948 TGGGGTGGGTGGAAGGATGGAGG - Intergenic
1039947952 8:42146188-42146210 TTGAGTAGCTGGATGGATGGTGG + Intergenic
1043848484 8:85188846-85188868 TAGGGTTGAGGGAAGGATGACGG + Intronic
1045062919 8:98424358-98424380 TAGTGTAGCTGGAAGCATGTTGG + Intronic
1046478249 8:114778368-114778390 GAGGGGAGAAGGAAGGATGGGGG + Intergenic
1046702388 8:117416122-117416144 TTGAGTAGATGGAATGAGGATGG - Intergenic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1049401675 8:142430427-142430449 AAGAGTAGTTGGAAGGACTGAGG + Intergenic
1049464376 8:142744310-142744332 TGGATTGGATGGATGGATGGGGG + Intergenic
1049464984 8:142746981-142747003 ATGAGTGGATGGATGGATGGTGG + Intergenic
1049474788 8:142791823-142791845 ATGAGAAGATGGATGGATGGAGG - Intergenic
1049474885 8:142792482-142792504 AAGTGTAGATGGAAGGAGGATGG - Intergenic
1049760386 8:144329495-144329517 TAGAGTGGGTGGAAGGATGGAGG - Intergenic
1049819070 8:144623296-144623318 CAGAGTACAAGGAAAGATGGTGG + Intergenic
1051066014 9:13103995-13104017 AAGAGAAAATGGAAGGAGGGAGG - Intergenic
1052077323 9:24159231-24159253 TAGAGGAGGTGGAGGGCTGGGGG - Intergenic
1052300343 9:26946776-26946798 GAGAGCAGAGGGAAGGCTGGGGG + Intronic
1052777286 9:32744904-32744926 TAGAGTAGAGAGCAGAATGGTGG + Intergenic
1054191271 9:61987058-61987080 ATGAATAGATGGATGGATGGTGG - Intergenic
1054647097 9:67600659-67600681 ATGAATAGATGGATGGATGGTGG + Intergenic
1054916025 9:70496149-70496171 TAGAGCAAGTGGGAGGATGGGGG - Intergenic
1056110080 9:83386402-83386424 TAGAGTAAAGGAAAGGATGGGGG - Intronic
1057282221 9:93721079-93721101 AACAGAAGATGGCAGGATGGAGG - Intergenic
1057981934 9:99671433-99671455 GGGAGTAGATGGAGGAATGGAGG - Intergenic
1059467167 9:114476316-114476338 TTGAGCAGATGGGAGGGTGGGGG - Intronic
1059624661 9:116049808-116049830 TCGAGTAGATGCCAGGGTGGAGG - Intergenic
1059761690 9:117343946-117343968 GAGAGAAGAAGGAAGGAGGGGGG + Intronic
1059844115 9:118252463-118252485 TAGAGTAAGTGGAAAGAGGGAGG - Intergenic
1060430292 9:123545412-123545434 CACAGTTGATGGAGGGATGGTGG - Intronic
1060697672 9:125723154-125723176 TTAAGTAGATGGGATGATGGGGG + Intergenic
1061431601 9:130534772-130534794 AAGTGAAGATGGAAGAATGGAGG + Intergenic
1062050604 9:134444634-134444656 AAGAGAAGAGGGAAGGAAGGAGG - Intergenic
1062201294 9:135304209-135304231 TTGAGTGGATGGATGGATGATGG + Intergenic
1062201357 9:135304492-135304514 TTGAGTGGATGGATGGATGATGG + Intergenic
1062281306 9:135752994-135753016 ATGAGTGGATGGATGGATGGAGG + Intronic
1185497528 X:566566-566588 ATGAGTAGATGGATGGATGGTGG + Intergenic
1185543724 X:925204-925226 ATGAATAGATGGAAGGATGGTGG + Intergenic
1185753425 X:2632733-2632755 TGGAGCAGATGGCAGGATGGGGG - Intergenic
1185759845 X:2682038-2682060 AGGAATGGATGGAAGGATGGTGG + Intergenic
1186017718 X:5216761-5216783 GATAGTAGATAGAAAGATGGTGG + Intergenic
1186342611 X:8659965-8659987 GAGAGTAGATGGCAGGTTGGAGG + Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187215012 X:17267662-17267684 TAGAGGAGTGGGAAGGAGGGGGG + Intergenic
1187934109 X:24319314-24319336 TAGGGTAGGGGGAAGGATGAAGG + Intergenic
1188243787 X:27818448-27818470 TAGTGTAGATTCAAGGAGGGGGG + Intronic
1189182763 X:39019086-39019108 TAGCGTGGAAGGAAAGATGGGGG - Intergenic
1189197146 X:39162252-39162274 GAGAGAAGAAGGAAGGAAGGTGG - Intergenic
1190534620 X:51413537-51413559 AAGAGAAGAGGGAAAGATGGAGG - Intergenic
1190578055 X:51861132-51861154 TAGAATAGATCAAAAGATGGTGG - Intronic
1192239671 X:69319284-69319306 AAGAGTAGCTGGGAGGATGTGGG + Intergenic
1193584626 X:83305877-83305899 TCTAGCTGATGGAAGGATGGGGG + Intergenic
1194644593 X:96443538-96443560 TATAGTAGATGCTAGGATGTGGG - Intergenic
1195012342 X:100745038-100745060 TAGAGTAGATACAAGCATAGTGG - Intergenic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1199246692 X:145613170-145613192 TAGAGTAGCTGGGATTATGGGGG - Intergenic
1200683159 Y:6236427-6236449 AAGAGTAGATGGAAGGAGAGAGG + Intergenic
1201049473 Y:9917959-9917981 AAGAGTAGATGGAAGGAGAGAGG - Intergenic
1201470005 Y:14322715-14322737 GAAAGAAGATGGAAGGAAGGAGG - Intergenic
1201901220 Y:19047199-19047221 TTGAGTGGATGGATGAATGGCGG + Intergenic