ID: 1140681727

View in Genome Browser
Species Human (GRCh38)
Location 16:77391878-77391900
Sequence CCTTCTTTCCATGATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140681727_1140681732 0 Left 1140681727 16:77391878-77391900 CCATCCACATCATGGAAAGAAGG 0: 1
1: 0
2: 2
3: 19
4: 216
Right 1140681732 16:77391901-77391923 TGGTTTGGTGAAACAGACAGAGG 0: 1
1: 0
2: 1
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140681727 Original CRISPR CCTTCTTTCCATGATGTGGA TGG (reversed) Intronic
900752624 1:4408330-4408352 ACTTCTCTCCCTGTTGTGGATGG - Intergenic
900955365 1:5883388-5883410 CTTTCTCCCCATCATGTGGAGGG - Intronic
901455829 1:9362201-9362223 CCTTCCTTCCATGTCGGGGAGGG + Intronic
906632303 1:47382042-47382064 CATTATTTACATGATTTGGAGGG + Intergenic
907167041 1:52421993-52422015 CCTGTTCTCCAAGATGTGGAAGG + Intronic
909391143 1:75124318-75124340 CCTTCTATCCATCATTTGGAAGG + Intergenic
911693320 1:100860287-100860309 CCTTCTTCCCATGATGGTGTAGG + Intergenic
911733222 1:101311066-101311088 ACTTCTTGGCATGAAGTGGAAGG - Intergenic
911902734 1:103525732-103525754 CCTTCTTTCCCTGAAGTGGCTGG + Exonic
912926558 1:113918271-113918293 CCTTCTTACCTTGAGGTGGGGGG - Intergenic
913360612 1:117976362-117976384 CCTTGTTACCATGCTGAGGAAGG + Intronic
914172250 1:145235548-145235570 TCTTGTTTCCATTGTGTGGATGG + Intergenic
916389853 1:164319867-164319889 CCTTCCTTCCAGGTTGAGGAGGG + Intergenic
917508948 1:175654369-175654391 CCTTCTTTCCAAGATGAAGGGGG - Intronic
917793639 1:178515930-178515952 CTTTCCCTCCATGATATGGAAGG - Intronic
920375939 1:205508032-205508054 CCTTCTTTCCCTGAGGTAGGAGG + Intronic
920876932 1:209845102-209845124 CCTTGTTCCCAGGATGGGGAGGG + Intronic
921366141 1:214376210-214376232 CCTTCTTACCTTGATGTGGGAGG + Exonic
922551758 1:226499118-226499140 CCATCTGCCCATGATGCGGAGGG - Intergenic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
1065443657 10:25775569-25775591 CTTTATTTCCATGATTGGGATGG - Intergenic
1065784698 10:29202406-29202428 CCTTCCTTTCAGGATTTGGAGGG + Intergenic
1067358273 10:45551566-45551588 CCTGCTTTCCATAATGTGCGTGG + Intronic
1069324869 10:67220992-67221014 CCTGTTTTCCATGATGTTAATGG - Intronic
1070323564 10:75372981-75373003 CCTTCTTTCCTTCCTCTGGAAGG - Intergenic
1071057053 10:81524135-81524157 CCTTTTTTCCATGAAGCTGAAGG + Intergenic
1073219326 10:101856849-101856871 TCTCCTTCCCATAATGTGGAGGG + Intronic
1073764522 10:106667348-106667370 CATTGTATCCATGATGAGGAAGG - Intronic
1074358695 10:112807910-112807932 CCTTCTTTCCAGGCTGGGCATGG + Intronic
1074905661 10:117861370-117861392 CCTTTTTCCCATGGTGTGCAGGG + Intergenic
1075501983 10:122983365-122983387 CTTTCTTCCCATCAGGTGGATGG - Exonic
1076049741 10:127323077-127323099 CATTCTTCCCATGATGGAGAAGG - Intronic
1076434533 10:130431020-130431042 CCTTCTCTCCATGTTTGGGATGG + Intergenic
1076690191 10:132219794-132219816 CCTCCTCACCATGATGTGGGGGG - Intronic
1077432872 11:2524748-2524770 GCTTCTTCCCAGGCTGTGGAGGG - Intronic
1077994489 11:7441767-7441789 ACTTCTGGCCATGATGTGTAAGG - Intronic
1078442621 11:11379771-11379793 CCATCTTTCCAGGAAGTGGATGG + Intronic
1081645719 11:44788878-44788900 TCTTCTCTCCATGAAGTGGCAGG - Intronic
1082967783 11:58985477-58985499 CTTTTGTTCCTTGATGTGGATGG + Intronic
1085686855 11:78631328-78631350 CCTTCTTTCCCACAAGTGGAAGG + Intergenic
1085706703 11:78792917-78792939 TTCTCTTTCTATGATGTGGAAGG + Intronic
1085745013 11:79107587-79107609 CCTTGTGTCCATGATGAGAATGG + Intronic
1085765282 11:79276811-79276833 CCTTCTCCCCAGGATGTGGGTGG - Intronic
1086374046 11:86182629-86182651 CCTTCTTCCAAGGCTGTGGATGG + Intergenic
1086512992 11:87580251-87580273 TCTTCTCTCCAGGATCTGGATGG + Intergenic
1087466083 11:98508106-98508128 CTTTCTCTCCATCAAGTGGAGGG + Intergenic
1087698616 11:101410819-101410841 CCTTCTTTTCATCACGTTGATGG - Intergenic
1091286023 11:134409025-134409047 CCTTGCTTCCAGGATGAGGATGG - Intronic
1094375292 12:29783301-29783323 CCTCCTCTCCAGGATGTGCATGG - Intronic
1094667679 12:32537538-32537560 TGTTCTTTCAATGATGTGCAAGG + Intronic
1096618152 12:52846282-52846304 CCTTGTCTCCAGGATGTGGATGG - Exonic
1098479936 12:70945801-70945823 CCTTCTCAGCATGATGTGGAAGG - Intergenic
1098587151 12:72167368-72167390 TGTTCTTTCCATGATGTAAAGGG - Intronic
1099907435 12:88789354-88789376 CCATCTTTCAATGATGGAGAAGG + Intergenic
1100654209 12:96623026-96623048 CTGTCCTACCATGATGTGGAAGG - Intronic
1100706098 12:97202113-97202135 TCTTCCTTCCATGATGTGGGTGG - Intergenic
1101615341 12:106330758-106330780 CCTTCTTTCCATTGTCTAGAGGG + Intronic
1101760188 12:107651965-107651987 CCTACTTTCCTTGTTCTGGAGGG - Intronic
1102131778 12:110536769-110536791 TGTTCTTTCCATGATGGGGATGG - Exonic
1102631691 12:114286520-114286542 ACCTCTCTCCATGATATGGATGG - Intergenic
1104415448 12:128593897-128593919 CATTCTTTCCATGATTTGGTAGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105609272 13:21954041-21954063 CCTTCTTTTCAGGCTGTGGTTGG + Intergenic
1106339779 13:28817735-28817757 CTTTCTTTGCATGAAGTGGGTGG - Intergenic
1106343082 13:28849933-28849955 CCTTGTTTCCTGGATTTGGAGGG - Intronic
1106747457 13:32720204-32720226 GCATCTTTTCATGATTTGGAAGG - Intronic
1106818179 13:33433027-33433049 CATTTGTTCCATGATTTGGAAGG - Intergenic
1106983159 13:35314144-35314166 CCTTCTGTCTATGAAGTGGCAGG + Intronic
1108056989 13:46494973-46494995 CCTTCTTCCCATTATGTGATTGG - Intergenic
1110300269 13:73918413-73918435 CCTCCAGTCCATGATGTAGATGG + Intronic
1111905374 13:94249667-94249689 CCTGGTTTCCATGATGGGGTTGG - Intronic
1114439210 14:22732718-22732740 CCTTCTCTCCCTCATGAGGAGGG + Intergenic
1115480661 14:33858002-33858024 CCTTCCTGCCAAGATCTGGAGGG - Intergenic
1116533617 14:46004135-46004157 TCTTCTTTGCATGCTTTGGAAGG + Intergenic
1120062536 14:80001078-80001100 CTTTCTTAACATGATGGGGAAGG - Intergenic
1120603041 14:86536469-86536491 CATTCATACCATGATGTGGTTGG + Intergenic
1121576698 14:94994856-94994878 ACTTCTGTCCATGGTGGGGATGG - Intergenic
1121853639 14:97246588-97246610 CCTGCTTGCAATGAGGTGGATGG - Intergenic
1124581511 15:30959619-30959641 CCTTCTTTCCCCGACGTGGCTGG + Intronic
1126684821 15:51239477-51239499 CCTGCATGCCACGATGTGGATGG + Intronic
1131190897 15:90315780-90315802 CCTTCTTGCCAAGAGGAGGAAGG + Intergenic
1134332936 16:13266766-13266788 CCTTCCCTCCTTGATGTGCAAGG - Intergenic
1135190382 16:20349330-20349352 GCTTCTTTCCTTGTTTTGGAGGG - Intronic
1138925627 16:61587395-61587417 CCATCTTTCCATGGAGTGGATGG + Intergenic
1139130592 16:64138530-64138552 CACTCTTTACATGATGTGGCTGG + Intergenic
1139149637 16:64366096-64366118 TCTTCTTTCCATTATGGGAATGG + Intergenic
1139712153 16:68784236-68784258 CCTACTTGCCATGATGTCCAAGG + Intronic
1140681727 16:77391878-77391900 CCTTCTTTCCATGATGTGGATGG - Intronic
1140875607 16:79149917-79149939 CCCTTTTTCAGTGATGTGGATGG - Intronic
1143812130 17:9480575-9480597 CCATCTTTCCATCTTTTGGAAGG - Intronic
1145822281 17:27848121-27848143 CTTTATTTCCATGCTTTGGAGGG - Intronic
1151836867 17:76587571-76587593 CCTTTTCTCCATGAAGTAGAGGG - Intergenic
1151898674 17:76997258-76997280 CTTTATTTCCATGCTGTGGTTGG - Intergenic
1152968767 18:141469-141491 CCTTTTTTCCAGGATGTTGAAGG + Intergenic
1155348173 18:24879174-24879196 CTTTCTTTCTGTTATGTGGAAGG - Intergenic
1155822818 18:30399380-30399402 ACTTCCTTCCACAATGTGGATGG - Intergenic
1157947925 18:52002091-52002113 TCTCCTTTCCCTGATGTGAAAGG + Intergenic
1158450994 18:57564996-57565018 CCGTCTATCCAAGTTGTGGAAGG - Intronic
1159434021 18:68392412-68392434 GCTTCTTTCCATTAAGTGTAGGG - Intergenic
1160579438 18:79875245-79875267 CTTTCTTCCCATGATGGGGCAGG - Intronic
1163187879 19:15652557-15652579 CCTTCTCTCCAGGATGAAGATGG + Exonic
1163189795 19:15669436-15669458 CCTTCTCTCCAGGATGAAGATGG + Intergenic
1163217017 19:15886298-15886320 CCTTCTCTCCAGGATGAAGACGG - Exonic
1163221200 19:15922420-15922442 CCTTCTCTCCAGGATGAAGATGG - Exonic
1167231934 19:48290521-48290543 CATTCCTTCCAGGATGGGGAGGG - Intergenic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
926746678 2:16164217-16164239 CTTGCATTCCATGATGTGGGTGG - Intergenic
928890582 2:36198997-36199019 GCTTCTTTTGATGAAGTGGATGG + Intergenic
929088297 2:38190195-38190217 CCTTTTTTCCATGGTGAGTATGG - Intergenic
929967374 2:46545201-46545223 CCTTCATTGGAGGATGTGGAGGG + Intronic
933732572 2:85468621-85468643 CCTTCTTTTCAGGATGTAGGAGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
937441307 2:121918376-121918398 GCTTCTTTCCAAGCTGGGGATGG + Intergenic
941707083 2:168670552-168670574 CCTTCTTTCCTCTGTGTGGATGG + Intronic
942539442 2:177000448-177000470 CCTTCTATCCATAATGTGCAAGG + Intergenic
942888935 2:180963718-180963740 CCATCTCACCATGAGGTGGATGG + Intergenic
943326368 2:186503259-186503281 TCTTCTATCCATGTTGTGAAGGG + Intronic
943852182 2:192738106-192738128 CTTTTTTTCCATGCTTTGGATGG + Intergenic
945299671 2:208204345-208204367 CTTTGTTGCCAGGATGTGGAAGG + Intergenic
945700783 2:213168852-213168874 CTTTCTTCCCTTGATTTGGATGG - Intergenic
946620395 2:221555586-221555608 ACTTGGTTCCATGATCTGGAGGG - Intronic
947711480 2:232318859-232318881 CCTTCTATCCATGATCTTTAGGG - Intronic
948075879 2:235164899-235164921 CCTTCTTTCCATGGCATGGCTGG + Intergenic
1171296860 20:24024731-24024753 CCTTCTTTCCAGGATGTGAAGGG + Intergenic
1173962960 20:47089262-47089284 CCCTCTTTCGCTGGTGTGGAAGG - Exonic
1178122811 21:29486142-29486164 TTTTCTTTCCATCATGCGGAAGG + Intronic
1179594209 21:42431191-42431213 CCTTCTCCCCATGCTGTGCAGGG - Intronic
1180717363 22:17880976-17880998 TCGTGTTTCCATGATGTGGGTGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181738378 22:24900055-24900077 CCTTCTGTGCGTGATTTGGAGGG + Intronic
1182744216 22:32593280-32593302 CCTCCTTTCCATGTTTTGGGAGG + Intronic
1183457828 22:37932419-37932441 CCTTCTTACCATGCTGGGGTGGG + Intronic
1183713096 22:39518087-39518109 TCTTCTTCCCATGCTATGGAAGG - Exonic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949161569 3:890118-890140 ACTATTTTCCATGATGTGGTAGG - Intergenic
949624151 3:5848950-5848972 CCTTCTTCCCATGAGGTGGGAGG - Intergenic
950219496 3:11183653-11183675 CCTTCTTTCCTTGATTTCCAGGG + Intronic
950273142 3:11635198-11635220 CCTTCTTCCAATAACGTGGATGG + Intronic
951506789 3:23455779-23455801 GGGTCTTTCCTTGATGTGGATGG + Intronic
953164182 3:40449833-40449855 CCTACTGTCTATGATGAGGAGGG + Intergenic
953541335 3:43821213-43821235 CCTTCATTCCCTGAGATGGATGG + Intergenic
955944404 3:64178596-64178618 TCTTCTTTCCCTGCTGTGGCAGG - Intronic
957030554 3:75235929-75235951 CATTGTTTCCATCATGTGGAAGG + Intergenic
958414744 3:93860387-93860409 CCTTCTTTCCCTGCTGTAGTAGG - Intergenic
958700890 3:97587693-97587715 CCTTATTTTCATAATGTGGTTGG + Intronic
959804271 3:110532174-110532196 CATTCTTTCCATTATGCAGATGG - Intergenic
962613658 3:137103220-137103242 CCTTCTTTGTGTGATATGGAAGG + Intergenic
964896988 3:161610265-161610287 CTTGCTTTCCATATTGTGGAAGG + Intergenic
966125003 3:176565567-176565589 GCTTCTTTTCATGATTTCGAGGG - Intergenic
966576249 3:181505864-181505886 CCTTCTTTCCGTGTTTTGGGTGG + Intergenic
966748675 3:183301909-183301931 CCTCCATTCCCTGATGTGAATGG + Intronic
967199663 3:187060946-187060968 CCTTCTTCCTGTGATGAGGAAGG - Intronic
969697915 4:8745655-8745677 TCTTTTTTCCAGGATGTGCACGG - Intergenic
971449795 4:26789002-26789024 CCTTTTTTCATTTATGTGGATGG + Intergenic
974458333 4:62156962-62156984 CCTTCTTTCCTGGATTGGGAAGG + Intergenic
975238946 4:72034105-72034127 CCTTTTTTCCATAATAAGGAGGG - Intronic
978150065 4:105423912-105423934 CCTTACTTCCATGATTTTGATGG - Intronic
978870837 4:113575204-113575226 CTTTCTATCCATGGAGTGGATGG - Intronic
979970380 4:127127575-127127597 CCTTCTTTCCCTGTTGTGTGAGG + Intergenic
980538433 4:134160473-134160495 CCTTCTTTCCATGAATTCAAAGG - Intergenic
981610788 4:146591424-146591446 CCTCCCTTCCATTATGTAGAGGG - Intergenic
982175781 4:152704433-152704455 CCTTGTTTCCATGATGGGCAAGG + Intronic
984233344 4:177127006-177127028 GTTTCTTTACATCATGTGGAAGG + Intergenic
984264955 4:177487365-177487387 ATTACTTTCCATAATGTGGATGG - Intergenic
985588482 5:752887-752909 CCTTCTTTCCTGGATGAAGAGGG - Intronic
985603153 5:845342-845364 CCTTCTTTCCTGGATGAAGAGGG - Intronic
985902705 5:2809059-2809081 CTGTCTTTCCATGATGTGTGGGG + Intergenic
987309262 5:16666952-16666974 CCACCTTTCCCTGATGAGGAAGG - Intronic
988845690 5:35125371-35125393 CCATCTTTCCCTGATGGTGAGGG + Intronic
988986946 5:36629716-36629738 CCTCCTTTCCATCATTTTGAAGG - Intronic
989849341 5:46189276-46189298 CCTTTTTTCCATTGTGTGAATGG + Intergenic
991416007 5:66393616-66393638 CTGTCTTTCCATCATGTGGAAGG + Intergenic
993013941 5:82514398-82514420 ATTGCTGTCCATGATGTGGATGG + Intergenic
995950241 5:117703590-117703612 CCTTCTTTTCCTGAAGTTGAGGG - Intergenic
997173020 5:131743723-131743745 CCTTCTTTCCACCATGTAAAGGG + Intronic
997202972 5:132023876-132023898 GCTTCTTTCCCAGGTGTGGATGG + Intergenic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1006245353 6:32729788-32729810 GGTTCTTTCCTTGATGTTGATGG - Intergenic
1006356281 6:33560362-33560384 CCTGCTTTCCATCAGGAGGAAGG + Intergenic
1009063384 6:58424713-58424735 CTTTTTTTCCGTTATGTGGATGG - Intergenic
1009251048 6:61299294-61299316 CTTTTTTTCCATTATGTGGATGG - Intergenic
1010021675 6:71167559-71167581 CCTTTTTTCTATAATCTGGAAGG - Intergenic
1010673607 6:78716330-78716352 CCTTATTTACATGATGTTGTGGG - Intergenic
1012035500 6:94133009-94133031 CCTTCTTTCAGTGATATAGAGGG + Intergenic
1018183422 6:161244057-161244079 CCTTGTTTCCACCTTGTGGAAGG + Intronic
1018865987 6:167747615-167747637 ACTCCTGTCCATGCTGTGGAAGG + Intergenic
1019019147 6:168902903-168902925 CCCTCCTTCCACAATGTGGATGG + Intergenic
1019403875 7:872345-872367 CCTTCTCTTACTGATGTGGAGGG + Intronic
1021407806 7:20293615-20293637 CCTCCGTTCCATGATAGGGAAGG + Intergenic
1022265608 7:28751269-28751291 CCTTCTTTGAATGCTGGGGATGG - Intronic
1023314526 7:38921610-38921632 CCTTCTTTGCAAGATTTGGATGG + Intronic
1023655248 7:42413167-42413189 CATTTTTACTATGATGTGGAGGG + Intergenic
1024646474 7:51375259-51375281 CCTTCTTTCCAGGCAGTGGTGGG + Intergenic
1025019637 7:55470805-55470827 TCTTGTTTCCATTGTGTGGATGG - Exonic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1027432496 7:78129064-78129086 CTTTATTTCCATGATCTGTATGG + Intronic
1028797848 7:94925271-94925293 ATTTCTTTCCATAATGTGGGTGG - Intronic
1029357335 7:100061886-100061908 CCCCTTTTCCCTGATGTGGATGG + Intronic
1031743467 7:125465273-125465295 CTTTCTTTCTATAATGTTGAAGG + Intergenic
1033535969 7:142312584-142312606 CCCTCTGTCCCTGAAGTGGAGGG - Intergenic
1033539623 7:142344903-142344925 CCCTCTGTCCCTGAAGTGGAGGG - Intergenic
1034275848 7:149823548-149823570 CCTTCTTTCTGTGATGTCCATGG + Intergenic
1034552666 7:151831628-151831650 CCTTGTTTCACTGATGTGGCAGG + Intronic
1036625743 8:10469817-10469839 CTTCCTTTCCATGTTGTAGAAGG - Intergenic
1038404000 8:27308511-27308533 CCTTCTTACCAAGTGGTGGAGGG + Intronic
1044491123 8:92816014-92816036 CCTGCTTTCCTTGATTTGGTAGG + Intergenic
1044738803 8:95304769-95304791 CCTTCTCTTCAGGATTTGGAAGG - Intergenic
1045853823 8:106738328-106738350 CCTTATTTTGATGATGTGAAAGG - Intronic
1046235571 8:111420175-111420197 CTTGGGTTCCATGATGTGGAGGG + Intergenic
1047032075 8:120892970-120892992 GTTTCTTTCCATGAGGAGGATGG + Intergenic
1048578621 8:135712457-135712479 TCTTCTTTCCCTGACTTGGAGGG + Intergenic
1050946760 9:11531362-11531384 ACTTCTTTCCATGTTGTTTAGGG + Intergenic
1051732124 9:20155052-20155074 CCTTCTTTCCTTGATGGGGATGG - Intergenic
1051836849 9:21348483-21348505 CCTTCATTTCATGATGAGGCAGG + Intergenic
1052270276 9:26621203-26621225 CCTTAATTCCATGAGGTGTATGG - Intergenic
1053132128 9:35621694-35621716 CTTTCTTCCCATGATGGGAAAGG - Intronic
1054909675 9:70442781-70442803 CCTCCTTTCAAAGAGGTGGAGGG - Intergenic
1054922625 9:70557333-70557355 CCTTGTTACCATGATGATGATGG + Intronic
1055263536 9:74469017-74469039 CATTCCTTCTATTATGTGGAAGG + Intergenic
1055395103 9:75865748-75865770 CTATCTTTCCATGTTGTGAAAGG - Intergenic
1056070127 9:82977547-82977569 TCTTCTTAACATGATGTCGAAGG - Intergenic
1059860462 9:118454929-118454951 ACTTCCTTCCATCATCTGGAAGG + Intergenic
1060086268 9:120705429-120705451 CATTCTTTCCATGATCTTTAAGG - Intronic
1185688794 X:2135632-2135654 CCCTCTCTCCATAATGTGGGTGG - Intergenic
1187510414 X:19912715-19912737 CCTACTTTTTATGATGTGGGAGG + Intergenic
1189388809 X:40558756-40558778 CCATCTTCCCATTATATGGATGG + Intergenic
1190289587 X:48983470-48983492 CCTTTTTTCGATGTTGTGGAAGG - Intronic
1190488003 X:50949054-50949076 CAATCTTTCCATACTGTGGAAGG - Intergenic
1190915148 X:54806155-54806177 CCAACTTGCCATGATTTGGAAGG + Intergenic
1192087118 X:68111383-68111405 ACTTCTTGCCATGGTGTGGCTGG - Intronic
1194477961 X:94382837-94382859 CCTTTTTTTCATCATGTGTATGG - Intergenic
1195288008 X:103404254-103404276 CCTTCATTCCTACATGTGGAGGG - Intergenic
1198620463 X:138502930-138502952 CTTTCTTTGCATGATTTGTATGG + Intergenic
1199371031 X:147048234-147048256 ATTTTTTCCCATGATGTGGACGG - Intergenic
1202368488 Y:24182567-24182589 CCTTCTGTCCAGTATGTGCATGG - Intergenic