ID: 1140682035

View in Genome Browser
Species Human (GRCh38)
Location 16:77394568-77394590
Sequence CTTAATATACAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140682030_1140682035 24 Left 1140682030 16:77394521-77394543 CCATTAGAAATTTGTGTGAAAAG 0: 1
1: 0
2: 3
3: 33
4: 350
Right 1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140682035 Original CRISPR CTTAATATACAGAAAGAGGA GGG Intronic
903073421 1:20741653-20741675 CTTAACCTACAAAATGAGGAAGG - Intergenic
905749749 1:40451634-40451656 CTTAAAATAGAGAAAGACGTGGG + Intronic
907629605 1:56067027-56067049 CTTAATTTCCACAAAGAAGAAGG + Intergenic
908142045 1:61195489-61195511 GATAATATACAGACAGAGGAGGG - Intronic
908330505 1:63066220-63066242 CTTAAAAGAGAGAAAGAGGGAGG - Intergenic
908761532 1:67517205-67517227 CTAAATGGAAAGAAAGAGGAAGG + Intergenic
909132253 1:71752358-71752380 CTTTATATACAAAAATAGGTAGG + Intronic
911887199 1:103318417-103318439 ATTATTATATAGAGAGAGGAAGG + Intergenic
914539215 1:148594857-148594879 CTAAAAATACAAAAAGTGGATGG - Intronic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
916311404 1:163402628-163402650 CTTGAGATACATGAAGAGGAGGG + Intergenic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917311913 1:173687696-173687718 CTCAAAATACAGAACCAGGAAGG - Intergenic
917910991 1:179645943-179645965 CTAAATATAAAGATAGAGAAGGG - Intronic
918236631 1:182586634-182586656 GTTAATTTCCAGGAAGAGGAAGG - Exonic
918695201 1:187537486-187537508 ATTAATATAGAGAAAAAGCAGGG - Intergenic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
921487012 1:215726989-215727011 TGGAATATACAGAAACAGGATGG - Intronic
921790929 1:219289753-219289775 CTTAATTTATAAAATGAGGATGG - Intergenic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
923200351 1:231705036-231705058 CTTAAAATACAGACAGACCAAGG + Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924310395 1:242735586-242735608 CTTTATATATTGAAAGAGCAAGG - Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
1062852230 10:753489-753511 CCTAATACACATAAAAAGGATGG + Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063745220 10:8871644-8871666 CTTAAAATGGAGAAAGAGAACGG + Intergenic
1064630438 10:17305396-17305418 CGTAATATCCAGGAAGAGAAAGG + Intergenic
1065429337 10:25637928-25637950 CTTAATATACAGAAATAGGCCGG + Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1068101731 10:52562976-52562998 CTTAATATAGAAAAAAAAGAGGG - Intergenic
1068805167 10:61187064-61187086 ATTAGAATTCAGAAAGAGGATGG + Intergenic
1068949201 10:62760567-62760589 CTTGGTTTAAAGAAAGAGGAAGG + Intergenic
1070081551 10:73193731-73193753 TTTAATATACACAAAGACTATGG - Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1072182253 10:92997323-92997345 CTCAGAATACAGAAACAGGAAGG + Intronic
1073383030 10:103095705-103095727 CTTAATAGACAGAAATAAAAGGG - Intronic
1074031333 10:109691607-109691629 GTTAAGATATAGAAAGAGGAAGG + Intergenic
1074416017 10:113267364-113267386 CTGAATAAACTGAAACAGGAAGG - Intergenic
1075295703 10:121273115-121273137 ATTAATATCCTGAAAGAAGAAGG + Intergenic
1075449727 10:122542061-122542083 ATTAACAGACATAAAGAGGATGG - Intergenic
1075455850 10:122584382-122584404 ATAATTATACAGAAAGAGAAGGG - Intronic
1075457973 10:122597085-122597107 ATAATTATACAGAAAGAGAAGGG - Intronic
1075764237 10:124879949-124879971 CTTATTATATAAAAAGAGGACGG + Intergenic
1077270035 11:1672000-1672022 CAAAATATACAGTATGAGGAGGG - Intergenic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1077848492 11:6051135-6051157 CTTAATATAAGCTAAGAGGAGGG - Intergenic
1078437216 11:11335315-11335337 ATTAATACACAGGAAGGGGAAGG - Intronic
1078470996 11:11586675-11586697 CTTAAAATACTGAAATAGGCCGG + Intronic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079719133 11:23788783-23788805 CATAATAAAGAAAAAGAGGAAGG + Intergenic
1080212712 11:29805590-29805612 CTTAATTTAAATAAAAAGGAAGG + Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1081449850 11:43160813-43160835 CTTAATGTCCAGGAAGAGAAAGG + Intergenic
1081451129 11:43171843-43171865 CTTAATGTCCAGGAAGGGGAAGG + Intergenic
1082995758 11:59253957-59253979 ATTAATCAAAAGAAAGAGGATGG - Intergenic
1083039734 11:59673861-59673883 CTGAAATTACATAAAGAGGAAGG + Intergenic
1084371643 11:68749258-68749280 CTTAGTGTACAGGAAAAGGATGG - Intronic
1086858208 11:91892343-91892365 GATAATATACAGACAGGGGAGGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087213013 11:95462223-95462245 CTTGGTCTACACAAAGAGGATGG - Intergenic
1087379287 11:97384434-97384456 CATAATATACAGAAAGCAGTTGG - Intergenic
1087423436 11:97962481-97962503 CTTGATATATAGAAAGGGGAAGG - Intergenic
1087733927 11:101810414-101810436 ATTAATATACAGGAAGGGGATGG + Intronic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1092659145 12:10720922-10720944 CTTCATATACACTAAGGGGAAGG + Intronic
1093799470 12:23355704-23355726 CTAAAGAGACAGAAATAGGAGGG - Intergenic
1094273946 12:28647119-28647141 ATTAATAAATAGCAAGAGGAAGG - Intergenic
1094305870 12:29018541-29018563 TTTAATATATATGAAGAGGAAGG - Intergenic
1094336401 12:29360767-29360789 ATTAGTTTACAGAAAGAGAAGGG + Intronic
1094386400 12:29898600-29898622 CTTAATAAACAAAAAGGGGGAGG + Intergenic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1096284784 12:50289715-50289737 CTTTATATACTAAAAGAAGAAGG - Intergenic
1097981100 12:65738828-65738850 CTTAAAAAAAAGAAAGAGGGAGG - Intergenic
1098254416 12:68602088-68602110 CTTAAAGGACAGGAAGAGGAAGG + Intergenic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099286558 12:80719089-80719111 CCTAATACACAGGAAGAAGAAGG + Exonic
1099298625 12:80863141-80863163 TTTGATAGAAAGAAAGAGGAAGG + Intronic
1099367376 12:81784588-81784610 TTTAATATATAGAAAGAATATGG - Intergenic
1099827902 12:87802184-87802206 ATAAATATACATAAAGAGCATGG + Intergenic
1099851629 12:88105346-88105368 CTTAAAAAAGAGAAAGCGGAGGG + Intronic
1100466006 12:94845951-94845973 CTTCATGTAAAGAAAGAGAATGG + Intergenic
1101982532 12:109420118-109420140 CTGAATATACAGAAACAGAGTGG - Intronic
1102831547 12:116006401-116006423 TTTATTATACAGTCAGAGGATGG - Exonic
1103240539 12:119409673-119409695 CTTTATTTACAGAAACAGGCAGG + Intronic
1104717393 12:131025222-131025244 TTTATCATACCGAAAGAGGATGG + Intronic
1105714585 13:23049910-23049932 AACAATATACAGAAAGAGGTTGG + Intergenic
1105801863 13:23911936-23911958 CCTAATATACAGAGAGAGGTGGG - Intergenic
1105914350 13:24898761-24898783 ATTAAAATACAGACAGTGGAAGG + Intronic
1106498940 13:30308584-30308606 TTTAATAGAAAAAAAGAGGAAGG + Intergenic
1110231809 13:73174892-73174914 CTTAAGATACAGCAAGAAGGAGG - Intergenic
1110572238 13:77018002-77018024 CTTAAAATACAAAAATAAGAAGG - Intronic
1110991997 13:82053568-82053590 TTTTATATACAGTAAAAGGAAGG - Intergenic
1111319649 13:86610180-86610202 CTTTATAGACAGATAGATGATGG - Intergenic
1113245872 13:108394723-108394745 CTTATTATTCAGAAAGAGACTGG - Intergenic
1113360418 13:109625968-109625990 TTCACTAGACAGAAAGAGGAGGG + Intergenic
1113684118 13:112268730-112268752 CTTAAAATGCTGAAAGATGATGG - Intergenic
1114834524 14:26187906-26187928 CTTAATTAACAGAAAAAGAAAGG + Intergenic
1114965336 14:27952557-27952579 CGAAATCTACAGAAAGAGGGGGG + Intergenic
1115149705 14:30270419-30270441 CTTAAGATACAGGCACAGGAAGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116517686 14:45820138-45820160 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1116519840 14:45834327-45834349 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1118075864 14:62298239-62298261 CTTATTCTTCAGATAGAGGAAGG - Intergenic
1118094159 14:62517706-62517728 GTTAATATAAAGAAGGGGGAAGG - Intergenic
1119476637 14:74934342-74934364 CTATATACACACAAAGAGGAAGG + Intergenic
1120093432 14:80360587-80360609 CTCAATATACTAAAAGAGGTTGG + Intronic
1120829963 14:88989257-88989279 CTTGATATCCAGAGAGAGAAGGG + Intergenic
1120931583 14:89854403-89854425 CTTAGTATCCTGAATGAGGAGGG - Intronic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1124169026 15:27355692-27355714 CATAATATACAAAAAGTGGGGGG + Intronic
1124452651 15:29810472-29810494 CTTACTATTCTGAAAGGGGAGGG - Intronic
1124559937 15:30762343-30762365 CTTAATACAAAAAAAGAGAAAGG + Intronic
1125035982 15:35123835-35123857 CTTGATAGAAATAAAGAGGAAGG - Intergenic
1125162774 15:36665548-36665570 GTTAGGATAGAGAAAGAGGATGG + Intronic
1126509961 15:49459535-49459557 ATTAAGATAAAGATAGAGGATGG - Intronic
1127185649 15:56477190-56477212 CTTAAAATGGAGTAAGAGGAAGG - Intergenic
1127225802 15:56927269-56927291 CTTTATATGCAGAAAAAAGACGG - Intronic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1127999980 15:64181910-64181932 CTGAATAGTCATAAAGAGGAGGG + Intronic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128655704 15:69460286-69460308 CTTAATATAAAGAAACTGGCCGG - Intergenic
1131156187 15:90077179-90077201 CTTAATAAACAAAATGGGGACGG + Intronic
1131721933 15:95178932-95178954 GTAAATATATAGAAAGAGGCTGG - Intergenic
1131899773 15:97074925-97074947 CTTAGCATACAGAAAGATGGCGG - Intergenic
1133813932 16:9182138-9182160 CTAAGTCTTCAGAAAGAGGATGG - Intergenic
1134688351 16:16174356-16174378 ATTAATAGACAGAAAAAGGAAGG - Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135534035 16:23278994-23279016 CTTAATAAAAAAAAAGGGGAGGG + Intronic
1135701716 16:24638414-24638436 CTCAAAAAACAGAAACAGGATGG + Intergenic
1137517743 16:49163140-49163162 CTTATTATAAAGAAAGAAAAGGG - Intergenic
1137950282 16:52777011-52777033 CTTAATATAAATATTGAGGAGGG + Intergenic
1138154065 16:54686171-54686193 CTCAATAAAAAGAAAAAGGAAGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1140898261 16:79344726-79344748 CCTAATATAAATAAACAGGATGG - Intergenic
1141351459 16:83301848-83301870 CTTAATTTAAAGAAATAGGCAGG + Intronic
1141794418 16:86260624-86260646 ATTGATATCCAGAAAAAGGATGG - Intergenic
1143359939 17:6361266-6361288 CTTAGTCTAAAGAAAGGGGAAGG + Intergenic
1144255404 17:13462654-13462676 CTGATTATAAACAAAGAGGAGGG + Intergenic
1144937109 17:18908681-18908703 CTCAATATTCAGGAAGTGGATGG - Intronic
1146620746 17:34395257-34395279 CTTGATATACAGGTAGATGAGGG + Intergenic
1147850386 17:43437965-43437987 CTTTATTTACAAAAACAGGATGG + Intergenic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150641073 17:66949896-66949918 ATAAAAACACAGAAAGAGGAGGG - Intergenic
1150988263 17:70224524-70224546 CTAAAAATTCAGAGAGAGGAAGG - Intergenic
1155931308 18:31711757-31711779 CTTAAAATAGTGAAAGAAGATGG - Intergenic
1156057810 18:33031672-33031694 ATTAACACAAAGAAAGAGGATGG - Intronic
1156272013 18:35544320-35544342 CTTTATAGAAAGATAGAGGAGGG + Intergenic
1156334348 18:36155172-36155194 CTAAAAATACAAAAAGAAGATGG - Intronic
1156627144 18:38922837-38922859 CCCAATAAACAGAAAGAGCATGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1158925512 18:62254192-62254214 CTTAATATATAAAATTAGGATGG - Intronic
1158990882 18:62867224-62867246 CATAATATTTAGAAAGAGAAAGG - Intronic
1160700989 19:507308-507330 ATCAATATACACAAAGAGGGAGG + Exonic
1163912019 19:20204274-20204296 GATAAAATACAGAAAGAGGCTGG + Intergenic
1164220575 19:23189570-23189592 CTTGATAAAAATAAAGAGGATGG + Intergenic
1165253728 19:34559967-34559989 TTTAATAGACAGACAAAGGAAGG + Intergenic
1166237684 19:41468382-41468404 CCTAATATTCAGAAAGGGAAAGG - Intergenic
1166245802 19:41524729-41524751 CCTAATATCCAGAAAGGGAAAGG - Intergenic
1167921367 19:52785855-52785877 CTAGATGTACAGAAAGATGAAGG - Intronic
1168674410 19:58266560-58266582 CGAAACATACAGAATGAGGAAGG + Intronic
925467770 2:4124715-4124737 GTTAAGATACAGATAGAGAAAGG + Intergenic
925509608 2:4610829-4610851 CTTGAGTTACAGTAAGAGGAGGG + Intergenic
927001174 2:18795412-18795434 CTTAAGTGAAAGAAAGAGGAGGG - Intergenic
927712688 2:25335626-25335648 CTTACTATAATGAAAGGGGAGGG - Intronic
927831619 2:26356130-26356152 CTTAAAATACAAAAAAAGTAGGG - Intronic
929037193 2:37705598-37705620 CTTAATAGACAGATAAATGAAGG - Intronic
929478849 2:42282323-42282345 CTTAACATACTGAAAGAGTCAGG + Intronic
930300261 2:49606717-49606739 CTTGATAGACATAGAGAGGATGG - Intergenic
930446383 2:51478510-51478532 TTTAATATAAAGATACAGGAAGG - Intergenic
930713044 2:54567212-54567234 CTTAAAGTACAGAGTGAGGATGG + Intronic
933008033 2:77021308-77021330 CATATTTTACAGACAGAGGAGGG + Intronic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
935362479 2:102258647-102258669 CTTAAACTACAGAAAAAGGAAGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
937552008 2:123106316-123106338 ATTAATATCCAGAAACAAGAAGG - Intergenic
937620712 2:123981612-123981634 CATAATATACAGAAAAAGGGGGG - Intergenic
937693926 2:124786749-124786771 CTTATTGTACAGAAACAGAAAGG - Intronic
937770188 2:125711677-125711699 CTTAATTTACAGAAAAAGTGTGG + Intergenic
938641415 2:133284636-133284658 GTTAATATACAGATAGAGATTGG - Intronic
938827580 2:135021001-135021023 ATTAATGTACATAAAAAGGAAGG + Intronic
939229403 2:139407101-139407123 ATAAATATAAAGAAAAAGGAAGG + Intergenic
939409949 2:141812200-141812222 GTTAATGTAGAGAAAGAGCATGG + Intronic
940004620 2:148999282-148999304 CTTCATCTACAGAAAGCGGGAGG - Intronic
940076493 2:149748003-149748025 ATTAATATACAGAAAGCTGGTGG - Intergenic
940610600 2:155986302-155986324 CTTATTAAACAGAAAGACAAGGG + Intergenic
941202774 2:162533476-162533498 TTTAAAATACAGAAAGAAAATGG + Intronic
941423743 2:165317642-165317664 CAAAATGTACAGAAAAAGGAAGG - Intronic
941431393 2:165418288-165418310 TTGAATATATAGAAAGATGAGGG + Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941537315 2:166739966-166739988 CTTACTTTACAGAATCAGGAAGG - Intergenic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941871425 2:170389798-170389820 CCTAATAGACTGAATGAGGATGG - Intronic
942572515 2:177328241-177328263 CTTATTATAGATAAAGAGAAAGG + Intronic
942905441 2:181174650-181174672 CTTACTATACAAAAATAGGCAGG - Intergenic
943139535 2:183963346-183963368 CTTAATTCACAGAAAGAGATGGG + Intergenic
943593702 2:189830197-189830219 CTTTATTTACAAAAACAGGAAGG + Intronic
943971640 2:194416023-194416045 AATAATATACACAAAGATGAAGG + Intergenic
943986903 2:194634047-194634069 CTTAAAATAAAGAAAGAAGGGGG + Intergenic
944568934 2:201023050-201023072 ATTAATATAAAGAAATAGGCTGG + Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945592615 2:211753358-211753380 CTTAATACACAAAATGAAGAAGG - Intronic
946629205 2:221647885-221647907 CTTAATAGACAGAGAAAGCATGG + Intergenic
947225435 2:227835427-227835449 CATACCATATAGAAAGAGGAAGG - Intergenic
947620775 2:231589510-231589532 CTTTATAGACAGGAAGAGGGTGG + Intergenic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1170848932 20:19986296-19986318 CTTAATAAACATAAAGAGTAGGG - Intronic
1171036952 20:21721058-21721080 AATAATATACATAAAGAGTAGGG + Intergenic
1171498047 20:25571176-25571198 CAAAATATCCAGAAAAAGGAAGG + Intronic
1172076056 20:32298512-32298534 CTTAAAAAACAAAAACAGGAAGG - Intronic
1172381610 20:34497738-34497760 CTAAAAATACAGAAAGTGGCTGG - Intronic
1172849825 20:37953551-37953573 GTTAAAATACAGAAACAGGCAGG + Intergenic
1174576394 20:51540896-51540918 CTTAATGAACAGAAAGACCACGG + Intronic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1177382864 21:20368351-20368373 CTTAATATATAGAAAGACTTTGG + Intergenic
1178047028 21:28706965-28706987 CTTAATGTACACAAAGAAGGTGG + Intergenic
1178066686 21:28912212-28912234 CTAAAAATACAAAAAGAGGCAGG - Intergenic
1179624179 21:42638939-42638961 CTTAATATACACACAGAGGCTGG + Intergenic
1182224170 22:28782731-28782753 CTAAATATACAAAAAAAGGCCGG - Intronic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
952470647 3:33647657-33647679 TTTTATATACAAAAACAGGAGGG + Intronic
953728111 3:45418573-45418595 CTTGATTTACAGAAACAGGTAGG - Intronic
954813533 3:53262870-53262892 CTAAAAATACAGAAATAGGCTGG - Intergenic
955005517 3:54965191-54965213 CTTTATTTACAAAAAGAGGCTGG + Intronic
955044300 3:55345273-55345295 CTGAGTATACTGAAAGAGAAAGG + Intergenic
956178496 3:66496798-66496820 CTTAATTTGCATAAACAGGATGG + Intronic
956352548 3:68353634-68353656 CTAAATATTCAGAAAAAGGCAGG + Intronic
957725413 3:84058981-84059003 TTTAACATACTGAAAGAAGAGGG - Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
960059685 3:113308263-113308285 CTTCATCTATGGAAAGAGGAGGG + Exonic
960442998 3:117711947-117711969 CTTAAAAGTCAGAAAGAGGTAGG - Intergenic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
962593183 3:136912646-136912668 CTTAAAAAAAAAAAAGAGGAGGG - Intronic
962989570 3:140566041-140566063 CTTGATATCCAGAAACATGAAGG + Exonic
963219701 3:142795479-142795501 CATCATATACAGAAAAAGAAAGG + Intronic
964938698 3:162127272-162127294 ATTAAAATACAGATAAAGGAGGG + Intergenic
964943736 3:162191920-162191942 CTTATTATACAAAAATAGGTTGG + Intergenic
965610244 3:170535867-170535889 GTTAATATATATAAAGATGAGGG - Intronic
965681815 3:171259597-171259619 ATTACTATACAAAAAGAGGGAGG + Intronic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
965997251 3:174899264-174899286 AGTAATATATAGAAAGAGAAAGG + Intronic
968315275 3:197718771-197718793 CACAATATACAAAAAGATGAAGG + Intronic
970113257 4:12662771-12662793 CATCAAATAGAGAAAGAGGAAGG + Intergenic
970190979 4:13517763-13517785 CTTAACATACGGAAAGAAAATGG - Intergenic
970287843 4:14538171-14538193 CTTATTATACAGACAGAAAATGG - Intergenic
970609892 4:17715157-17715179 CTTTATGTACAGAAATAGCATGG - Intronic
970670695 4:18393611-18393633 CTTAATATATAGAAAAACTATGG - Intergenic
970970576 4:21978921-21978943 CTTAAAAATCTGAAAGAGGAAGG - Intergenic
971080020 4:23199008-23199030 CTTACTACATAGAAAGAAGAGGG + Intergenic
971569080 4:28186807-28186829 ATAAATATCCAGATAGAGGAAGG - Intergenic
972538708 4:40020682-40020704 GTTGATCTACAGAAAGATGAAGG - Intergenic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
975157023 4:71083477-71083499 CTTAATAATCAGAATCAGGAAGG - Intergenic
975979637 4:80142892-80142914 CTTAAAATGTAGAAAGAGTAGGG - Intergenic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977390138 4:96398531-96398553 CTTAATACACTTAAAGAGGAAGG + Intergenic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
979453357 4:120899224-120899246 CTTACTATACAGCATGGGGATGG - Intronic
979586207 4:122420762-122420784 CATAATATACACATACAGGAAGG + Intronic
979834739 4:125350770-125350792 CTTACTGTAGAGAATGAGGAGGG - Intronic
980021351 4:127713924-127713946 ATTAATTTACAGAAAAAGAAAGG + Exonic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
982174877 4:152696248-152696270 TTTAACAGACAAAAAGAGGATGG + Intronic
984682614 4:182627288-182627310 CTTAATGTATAAAATGAGGATGG - Intronic
986503768 5:8428970-8428992 CTTAATATAGTGAATGAGGAAGG + Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987399958 5:17464450-17464472 CTAAAAATACAGAAATAGGAGGG - Intergenic
988497098 5:31754563-31754585 CTTAAAATACACAAAGAAGCTGG - Intronic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
989635089 5:43523505-43523527 CTTCCTGTACAGGAAGAGGAGGG + Intergenic
990478145 5:56181889-56181911 AGTAATATACAGAAATAGGCCGG - Intronic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
991594223 5:68286439-68286461 CGAAATATACAGAAAGTTGATGG + Intronic
992484845 5:77184681-77184703 CTTAAAAAATAGAAAGAGGCTGG + Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993955257 5:94224897-94224919 CTTAATTTAGAGACAGATGAAGG - Intronic
994181554 5:96772297-96772319 CTTAATCTTCAGAAAGGAGAGGG + Intronic
994391791 5:99199403-99199425 CGTAATATCCAGAAAGGGAAAGG - Intergenic
994927205 5:106132205-106132227 CTTAACATAAAGAAAGAAGAAGG + Intergenic
994934496 5:106236855-106236877 CTTAATTTAAAGAAATAGGCAGG - Intergenic
995098626 5:108271228-108271250 TTTAATAGACTGGAAGAGGAAGG - Intronic
996318478 5:122188003-122188025 TTTAATTAAAAGAAAGAGGAAGG + Intergenic
996926847 5:128837539-128837561 CTTAAAATAATGAAAGAGGTAGG - Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998263822 5:140651853-140651875 CTTAGTAGAAAGAAATAGGAAGG - Intronic
999112674 5:149135693-149135715 CCTAATATCCAGAAAGGGCATGG - Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
1004539079 6:16532105-16532127 CTTAATTTACAGAAACAGGCTGG + Intronic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1009362666 6:62834830-62834852 CTTAATATCCAGAAAGCGAGAGG + Intergenic
1011190005 6:84718594-84718616 CTTAAAATACAGAACCAGAAAGG - Intronic
1011800458 6:91008469-91008491 CTAAAAATACTGAAAGAGAATGG - Intergenic
1012099450 6:95012298-95012320 CTAAAAATACAGAAACAGGCTGG - Intergenic
1013359121 6:109377459-109377481 ATTAAAATACAGAAAATGGATGG + Intronic
1014300233 6:119672789-119672811 CTTAATATAAAGCCAGAGGAGGG - Intergenic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1016658414 6:146545911-146545933 CATAATTTACATAAAGAGTAAGG - Intronic
1016951182 6:149581714-149581736 CTTAATATACAGAGAGATATCGG - Intronic
1017557301 6:155584984-155585006 ATTTATAGACAGAAAAAGGAAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018410543 6:163541932-163541954 CATAAAATGCAAAAAGAGGAAGG - Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022717611 7:32912905-32912927 CTTTATATACTGTAAGAGAATGG + Intergenic
1023130959 7:37002819-37002841 CTTAGAATACAGAAAGAGCAAGG + Intronic
1023544686 7:41305893-41305915 CTCAAGATATAGAAAAAGGAGGG - Intergenic
1023954988 7:44878033-44878055 CTTTATATTTAGAAATAGGATGG - Exonic
1027580066 7:79981688-79981710 CTTAATGTACATACTGAGGAAGG + Intergenic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1028358934 7:89944309-89944331 CTTAGTCTACAGAAAGAGGTAGG - Intergenic
1028560573 7:92170365-92170387 CTAAATATCCAGATACAGGAAGG + Intronic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1029881292 7:103813157-103813179 ATTAATATGTAGAAAGAGAAAGG - Intronic
1029981896 7:104886659-104886681 CTTAATATGTAAAAAGAGGCTGG - Intronic
1030040302 7:105443688-105443710 CTTACTATAAAGAATCAGGAAGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031682918 7:124696427-124696449 CTTAATATAGAGAATAAGGAAGG + Intergenic
1032952401 7:136930134-136930156 CTTAAAACAAAGAAAGAGGCCGG + Intronic
1034135210 7:148761730-148761752 CTTTATTTACAGAAAAAGGCAGG + Intronic
1034851117 7:154494926-154494948 CTCGAGATACAGACAGAGGAGGG + Intronic
1034937847 7:155211252-155211274 CTTAAGATACAACAAGAGTAGGG + Intergenic
1036504294 8:9341389-9341411 TTTAAAAGACAGAAAGAAGATGG + Intergenic
1036764505 8:11539174-11539196 CATATTACACAGAAAGAGGCTGG - Intronic
1041768134 8:61441994-61442016 CTTGATATACAAAAGAAGGATGG - Intronic
1042011285 8:64247832-64247854 CTTTTTATCCAGAAAGAGAAAGG - Intergenic
1043021670 8:75009383-75009405 TCTAATAAACAGAAAGAGGCTGG - Intronic
1043052178 8:75397754-75397776 GGTCATATAGAGAAAGAGGAAGG + Intergenic
1043635002 8:82374667-82374689 CATAATATCCAGAAAGGGGGAGG + Intergenic
1043635258 8:82376179-82376201 CCTAATATCCAGAAAGGGAAAGG + Intergenic
1043806977 8:84683845-84683867 CTTAATATACAGAATAAGCTGGG - Intronic
1043880562 8:85537842-85537864 CTCAATACAAAGCAAGAGGATGG - Intergenic
1043956424 8:86365317-86365339 CTAAAAATACAGAAAGATGGAGG + Intronic
1044360966 8:91283233-91283255 TTAAAAATACAGAAAGAGAAGGG + Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045937056 8:107692152-107692174 ATAAATAAACTGAAAGAGGAAGG + Intergenic
1046086982 8:109449973-109449995 GTTAATGTACATAAAGTGGATGG + Intronic
1046191691 8:110803761-110803783 CTTAATTGACAGAAACAGGAAGG + Intergenic
1046200940 8:110926913-110926935 AATAATATAGAGAGAGAGGAGGG + Intergenic
1046552423 8:115733444-115733466 ATTTATATACAGAGAGAGAAGGG - Intronic
1046862914 8:119114888-119114910 CTACATTTACACAAAGAGGAAGG - Intergenic
1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG + Intronic
1048831859 8:138485419-138485441 CTTAATATCAACCAAGAGGATGG - Intronic
1049282889 8:141759496-141759518 CATTATTTAGAGAAAGAGGAAGG + Intergenic
1050224419 9:3435364-3435386 CTAAATATACAAAAAGATTACGG - Intronic
1050488076 9:6156277-6156299 CTAATTCTACAGAAATAGGAAGG + Intergenic
1050961724 9:11742119-11742141 CTTCATATTCAGAAAGAGTGGGG + Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051232338 9:14966381-14966403 CCTAATATTCAGAAAGAGAGAGG - Intergenic
1052362055 9:27572661-27572683 CTTTGTATTCAGAAACAGGAGGG - Intronic
1053296306 9:36916150-36916172 TTTAATATAAAGAGTGAGGAAGG + Intronic
1055114226 9:72589881-72589903 ATTACTATATTGAAAGAGGAAGG + Intronic
1055228603 9:74032030-74032052 CTTAAAATACAGAAAAAGTTGGG + Intergenic
1056961284 9:91126274-91126296 CTAAAAATACAAAAAGAGGCAGG + Intergenic
1057477688 9:95417212-95417234 CAAAATAAACACAAAGAGGATGG + Intergenic
1058400001 9:104604845-104604867 CTTCATGTACATGAAGAGGATGG + Exonic
1058400833 9:104617422-104617444 CTTCATATACATGAAGAGGATGG + Exonic
1060053300 9:120392111-120392133 CCTAATGGAAAGAAAGAGGAGGG + Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1061693005 9:132349909-132349931 CTTTATATCTAAAAAGAGGAGGG - Intronic
1185648826 X:1633932-1633954 CTAAAAATACAAAAAGAGGCCGG - Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1188673639 X:32911977-32911999 CTTAAAGTACAGGGAGAGGAAGG + Intronic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1190718225 X:53122603-53122625 CTTAGTATAGAGTAATAGGATGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1192057510 X:67787356-67787378 CTGATTATAGAGAAAGAGGCTGG - Intergenic
1192762519 X:74108094-74108116 CTTACTACACACAAAGATGATGG - Intergenic
1193151460 X:78128900-78128922 TTTAATATACATTAAGAGGCCGG + Exonic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1194222544 X:91213607-91213629 CTTCATATAGAGACAGAGGAAGG + Intergenic
1194426112 X:93740271-93740293 CTTAACATAGAGAAACATGACGG - Intergenic
1195357174 X:104049748-104049770 CTTAACATACTGGAAGAGGCTGG - Intergenic
1197620474 X:128742187-128742209 CTGAATATACAGGATCAGGAAGG + Intergenic
1197654577 X:129102698-129102720 GTTGATTTACAGAAAGAGCAAGG - Intergenic
1197674059 X:129310972-129310994 CTTAATATATAGTAAGATGTTGG - Intergenic
1197966238 X:132065325-132065347 CTTAATATTCAAAAAATGGAAGG - Intergenic
1198489237 X:137122401-137122423 CTTAAAATATAAAAACAGGAGGG + Intergenic
1198952882 X:142092827-142092849 CTTAATATAAAGTAAAAGGATGG + Intergenic
1200559072 Y:4677372-4677394 CTTCATATAGAGACAGAAGAAGG + Intergenic
1201502151 Y:14656698-14656720 CTTAATACACAAATAGTGGATGG - Intronic
1201773636 Y:17642231-17642253 CTTAAAATACAAAATTAGGAGGG - Intergenic
1201827920 Y:18263754-18263776 CTTAAAATACAAAATTAGGAGGG + Intergenic