ID: 1140684188

View in Genome Browser
Species Human (GRCh38)
Location 16:77417235-77417257
Sequence GTTTTAGAAGTGTGAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140684188 Original CRISPR GTTTTAGAAGTGTGAATGGG AGG Intronic
909333526 1:74444875-74444897 GTTATAGATGTGTAAATGTGTGG - Intronic
910680533 1:89859510-89859532 GGTTAAGGATTGTGAATGGGAGG + Intronic
912800459 1:112716655-112716677 ATTTGAGATGTGTGGATGGGTGG - Intergenic
913698656 1:121353178-121353200 TTTTTAGATGTGTGGGTGGGAGG + Intronic
914138891 1:144926857-144926879 TTTTTAGATGTGTGGGTGGGAGG - Intronic
915312692 1:155012242-155012264 GGTTTAGCAGCGGGAATGGGTGG + Intronic
916264155 1:162873378-162873400 GTTTTACATGTGTGAATTAGGGG - Intergenic
916279882 1:163038527-163038549 GGTTTTGATGTATGAATGGGAGG + Intergenic
916357819 1:163933033-163933055 GTTTTAACAGAGTTAATGGGAGG - Intergenic
918286811 1:183064469-183064491 GTTTTAGAAGTGTTTATGTTTGG - Intronic
919076890 1:192824438-192824460 GTTTTAGAAGTGTGATCATGAGG + Intergenic
920486062 1:206371815-206371837 TTTTTAGATGTGTGGGTGGGAGG + Intronic
920810791 1:209283671-209283693 GTGTTAGAGGTGTCAATGGTAGG - Intergenic
923102001 1:230824255-230824277 GTCTTAAAAGTGTGAGGGGGGGG - Intergenic
923242952 1:232103516-232103538 GTTTCACAAGTGTGTATAGGTGG + Intergenic
924683036 1:246257827-246257849 GTGTTGGAAGTGGGACTGGGTGG + Intronic
1063017049 10:2088740-2088762 GTGTTAGAGGTGGGAATTGGTGG - Intergenic
1064143771 10:12811267-12811289 GGATTACCAGTGTGAATGGGCGG + Intronic
1066427403 10:35320410-35320432 GTTTTAAAATTGTGAATGGATGG - Intronic
1067702183 10:48581971-48581993 GTTTGAGAAGTGTCAAAGGTAGG + Intronic
1067957649 10:50810020-50810042 GCTTTGGAGGTGTGAAAGGGTGG + Exonic
1067991315 10:51215900-51215922 TTTTTAGAAGTGTTCATGGAAGG + Intronic
1074466819 10:113691110-113691132 GGGTCAGGAGTGTGAATGGGAGG - Intronic
1075674402 10:124286387-124286409 GCTTTAGAGGTGGGCATGGGAGG + Intergenic
1075773432 10:124960719-124960741 ATTTTAAAAGTGGAAATGGGAGG - Intronic
1076547121 10:131252932-131252954 GATTTAGAAGTGTGCCTGGAAGG - Intronic
1078265685 11:9754946-9754968 GATTTAGAAGTGAGGGTGGGAGG + Intergenic
1079300885 11:19277979-19278001 GTTTTAGAAGTGGCAAAAGGCGG - Intergenic
1079616349 11:22498245-22498267 GTTTTACAAGTGAGAAGAGGAGG + Intergenic
1082084963 11:48042598-48042620 GGTTTAGAAGAGTGGAGGGGAGG - Intronic
1082857190 11:57818432-57818454 GTTTTTAAAGTGTGTATGTGGGG + Exonic
1085396557 11:76209689-76209711 GTTTTGGAAGTGGGAAGGGTGGG + Intronic
1087554943 11:99706198-99706220 GTTTCACAAGTGTGCATAGGTGG + Intronic
1088062113 11:105666979-105667001 CTTGTGGAAGTGTGAATGGGAGG + Intronic
1090849874 11:130562693-130562715 GTTTTAAATGTGTGATTTGGTGG - Intergenic
1091028494 11:132162471-132162493 GTGTGGGAAGTGTGGATGGGGGG + Intronic
1092488953 12:8927260-8927282 GTTTGAGGGGTGTGAATGGCTGG + Intronic
1095718099 12:45370829-45370851 TTTTTAGAAGAATGATTGGGAGG + Intronic
1097958396 12:65509545-65509567 GTTTTAGAAGTCTGACTGTTTGG - Intergenic
1100498763 12:95152868-95152890 GTTTTAAATGTGCCAATGGGGGG + Intronic
1101681985 12:106977801-106977823 GTTTTAGAAGAGAGAATGCAAGG - Exonic
1102160264 12:110763186-110763208 CTTGAAGAAGTGTGAATAGGTGG + Intergenic
1102955148 12:117054240-117054262 GTTGTAGGGGTGGGAATGGGAGG - Intronic
1103585203 12:121948054-121948076 GTGTTTGAAATGTGCATGGGAGG - Intronic
1103740574 12:123088484-123088506 GCTTTAGAAGTGAGAATGATGGG + Intronic
1104210122 12:126680828-126680850 GTTTTACAACTTTGACTGGGTGG + Intergenic
1104357086 12:128096752-128096774 GTCTTAGACATGTCAATGGGAGG - Intergenic
1104618087 12:130287071-130287093 GTCTTAGAAGTGAGAAAAGGAGG + Intergenic
1106164213 13:27227854-27227876 ATTCTAGAATTTTGAATGGGTGG - Intergenic
1107117574 13:36763450-36763472 GTTCTGGAAGTTTAAATGGGAGG - Intergenic
1107609566 13:42099536-42099558 GTCTCTGAAGTGTGAATGGCGGG + Intronic
1108176291 13:47796104-47796126 GTTTTAGAATTCTGAATTGTGGG + Intergenic
1109046731 13:57422583-57422605 GTTTTAGACATCTGAATGTGAGG - Intergenic
1109197874 13:59398614-59398636 GTATCAGAAGTGTGAAAGGAAGG - Intergenic
1109687644 13:65843075-65843097 GGTTAAGAATTGTCAATGGGTGG - Intergenic
1109710196 13:66149185-66149207 GATATAGATGTGAGAATGGGGGG - Intergenic
1110428236 13:75393426-75393448 ATTTTACAAGTCTGAATGGATGG + Intronic
1110715228 13:78695019-78695041 TTTTTAGAAATGTGATTGTGAGG - Intergenic
1111656830 13:91164479-91164501 TTTTTGGGGGTGTGAATGGGTGG - Intergenic
1112695208 13:101940249-101940271 GTTTTAAAAGGGTGATCGGGAGG + Intronic
1114840987 14:26261503-26261525 GTTTTAGAAGGCTGAACTGGTGG + Intergenic
1119345816 14:73923304-73923326 GTTTTAGAGTTGTTAATGAGAGG + Intronic
1121117271 14:91352592-91352614 GTTTTGGGCGTTTGAATGGGAGG - Intronic
1121583793 14:95049157-95049179 GTTTTTGAGGAGTGAATGGCAGG - Intergenic
1122680384 14:103456418-103456440 GCTGGAGAAGTGTGAATGAGGGG - Intronic
1123779173 15:23608375-23608397 GTTTTTGAACTCTCAATGGGTGG + Intronic
1126800583 15:52293904-52293926 GTTCTGGAGGTGTGAAGGGGAGG - Intronic
1127001416 15:54512016-54512038 ACATTAGAAGTGTGAATGGGAGG + Intronic
1127661815 15:61106608-61106630 GTTTGAGAAGTATAGATGGGAGG - Intronic
1129252107 15:74314764-74314786 GTTTTAGAAATGGAAATGGAGGG + Intronic
1130707072 15:86243466-86243488 AATATAGAAGGGTGAATGGGAGG + Intronic
1134058736 16:11186264-11186286 GATTTCCAAGTGTGACTGGGAGG + Intergenic
1140443145 16:75001969-75001991 GTGTCAAAAGTGTGTATGGGAGG + Intronic
1140684188 16:77417235-77417257 GTTTTAGAAGTGTGAATGGGAGG + Intronic
1141162531 16:81638847-81638869 GTTTTAGAATTCTGAAAGAGGGG + Intronic
1146698672 17:34933530-34933552 TTTTAAAAAATGTGAATGGGAGG - Intronic
1148642171 17:49196039-49196061 TTTGTAGAAGTGTAAATTGGTGG + Intergenic
1148916642 17:50986217-50986239 TTTTTAAAAGTGTGTGTGGGGGG + Intronic
1149543084 17:57483451-57483473 GTATTAGAAATGTGAATTTGGGG - Intronic
1149595720 17:57863452-57863474 GTTCTAGGAATTTGAATGGGGGG - Intronic
1150103113 17:62441380-62441402 GTTTTAGAACTGTGAACTGTGGG + Intronic
1150551773 17:66217350-66217372 GTGTACTAAGTGTGAATGGGGGG - Intronic
1150564414 17:66325968-66325990 TTTTTAGGTGTGTGAATGGATGG - Intronic
1151022299 17:70631453-70631475 GTCTTAGAAGTAGGAAAGGGAGG + Intergenic
1152480820 17:80551196-80551218 TTTTTGAAAGTGTGAAGGGGTGG + Intronic
1155503556 18:26511403-26511425 GTTTTAGAGCTGGGAATGGAGGG - Intronic
1158759398 18:60366648-60366670 GTTTTAGAAGTATGATTGTTAGG - Intergenic
1159294689 18:66469451-66469473 GTTTTAGCAGTATGAATGAATGG + Intergenic
1164685653 19:30164942-30164964 GCTTTAGAAGTGGGGGTGGGGGG + Intergenic
1165947111 19:39450253-39450275 TTCGTTGAAGTGTGAATGGGAGG + Intronic
1167056415 19:47113658-47113680 GTTTTAGGTGGGAGAATGGGAGG + Intronic
1167180041 19:47896135-47896157 TTTTTAGAAATCGGAATGGGGGG - Intergenic
925995040 2:9285347-9285369 GTGTTTGAAGTGGGGATGGGGGG - Intronic
932862444 2:75308330-75308352 GTTTTAGTAGTCTGAATAGGCGG + Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934583623 2:95468449-95468471 ATTTTAGAAGTGAGAAAGTGTGG - Intergenic
934595829 2:95608265-95608287 ATTTTAGAAGTGAGAAAGTGTGG + Intergenic
934786948 2:97017216-97017238 ATTTTAGAAGTGAGAAAGTGTGG - Intronic
936139655 2:109928489-109928511 ATGTTAGAAATATGAATGGGAGG + Intergenic
936205041 2:110442997-110443019 ATGTTAGAAATATGAATGGGAGG - Intronic
939214521 2:139218948-139218970 ATTTTATCAGAGTGAATGGGGGG + Intergenic
940737447 2:157469384-157469406 GTTCTAGAAGTATGAAGGGTTGG + Intronic
940778740 2:157910879-157910901 GTATCAGAAATGTGAAGGGGAGG - Intronic
942413084 2:175731944-175731966 ATTTTAGAAGTGTAAATTTGTGG - Intergenic
943692518 2:190882074-190882096 GTTTCAGAAGTGAGATTAGGAGG + Intronic
944480833 2:200155671-200155693 TTTTTGGAAGGGAGAATGGGTGG + Intergenic
944529316 2:200651723-200651745 CTTTTAAAACTGTGAAAGGGGGG + Intronic
945989464 2:216382117-216382139 GTTTTAGTGGTCTGAATGGAAGG + Intergenic
1170411654 20:16098588-16098610 GTTTTAGAACAGGCAATGGGAGG - Intergenic
1178051076 21:28748029-28748051 CTCTTAGAAGTGTGAATATGTGG - Intergenic
1184543220 22:45144091-45144113 GTTGTAAAAGTGTGTATGGAGGG + Intergenic
1184956578 22:47890944-47890966 TTTTTGGAACTGTGAGTGGGAGG - Intergenic
949310666 3:2694223-2694245 GCTTTAAAAGTGGGAATGGTAGG - Intronic
951025349 3:17822532-17822554 GTTTTTCAACTTTGAATGGGAGG - Intronic
955131869 3:56177883-56177905 TTTTTAAAAGTGAGAATAGGTGG - Intronic
955278952 3:57575148-57575170 GTTTTAAAAGTGGAGATGGGGGG - Intronic
956068515 3:65422438-65422460 TTTTTAGCTGTGTGACTGGGGGG + Intronic
957319341 3:78608925-78608947 GTTTTAAAAAAGTGAATAGGAGG + Intronic
959961879 3:112306790-112306812 GTTTTAAAAGGGTGTATTGGGGG - Intergenic
961706514 3:128790885-128790907 GTTTTTGAGGTGGGAAGGGGAGG - Intronic
962534652 3:136317002-136317024 GTTTTGCAAGAATGAATGGGAGG + Exonic
963051250 3:141145904-141145926 GGTTTTGAAGAGTGAATAGGAGG - Intronic
964385287 3:156140771-156140793 GGTTTAGAAGTGTGAAGTGAGGG + Intronic
965287223 3:166832281-166832303 ATTTTAGAAGAAAGAATGGGTGG - Intergenic
965998740 3:174920575-174920597 GTTTTAGTGGTATGAATGGAAGG - Intronic
966274855 3:178153129-178153151 GGTTTAGAAGGGTGAGGGGGAGG - Intergenic
966337257 3:178882293-178882315 GTATTACAAGGGTGAAAGGGAGG - Intergenic
967556100 3:190860912-190860934 GATTTAGAAGGGGGAAAGGGTGG + Intronic
970162693 4:13205208-13205230 GTTATAGCAGCCTGAATGGGTGG - Intergenic
970349979 4:15192668-15192690 TTCTAAGATGTGTGAATGGGTGG - Intergenic
972018137 4:34272328-34272350 GTTTTCTAAGTTTGAATGGGGGG - Intergenic
974689582 4:65279112-65279134 GTATTAGAAATGTGAAGAGGGGG + Intergenic
976183174 4:82418658-82418680 GTTTTAGAAGTGAGAGTAAGAGG - Intergenic
976294149 4:83453027-83453049 GTTTGATAAGTGTGACTGTGAGG + Intronic
978027628 4:103896920-103896942 GGGTCAGGAGTGTGAATGGGAGG + Intergenic
978589025 4:110304072-110304094 GTATTAGAAATAAGAATGGGAGG + Intergenic
979227389 4:118303007-118303029 GTTTCAGAGGTGAGAATGGGTGG + Intronic
980393807 4:132181872-132181894 GTTTTAGCAGTTTGGATGGAAGG - Intergenic
980839591 4:138241695-138241717 GTTTTTGAGGAGTGAATGGATGG - Intronic
982146237 4:152396295-152396317 ATTTTAAAAGGGTTAATGGGAGG - Intronic
982183998 4:152778330-152778352 GTTTCAGAAGGGTGACTTGGAGG - Intronic
982383776 4:154778295-154778317 GTTTTGGAAGTGTGGATTTGGGG - Intergenic
983886165 4:172982973-172982995 GACTCAGAAGGGTGAATGGGTGG + Intronic
986430848 5:7679586-7679608 GGTTCTGAAGTGTGAATGGCAGG + Intronic
988217695 5:28296727-28296749 GTCTTAGAAAAGTGAATTGGTGG - Intergenic
988422973 5:31028968-31028990 GTTTTAAACATGTGAATGAGAGG + Intergenic
990122297 5:52470209-52470231 GTTTTAAAAGTATGAAAGTGAGG - Intergenic
993350539 5:86844614-86844636 GTTTTCTAAGTGTGGCTGGGAGG - Intergenic
998051691 5:139041314-139041336 GTTTAAGAAGTGTGAAATGCAGG - Intronic
1000114218 5:158138108-158138130 GTTTCACAAGAATGAATGGGGGG + Intergenic
1003872674 6:10414436-10414458 GCTTTAGAAGTGGGGGTGGGGGG + Intronic
1006382157 6:33705325-33705347 GTTTCAGAAGTGAGAGTGGTCGG - Intronic
1007217918 6:40255283-40255305 TAGTTAGAAGTGTGAATGGCTGG + Intergenic
1008365404 6:50673247-50673269 GTTTTAGAAGTGAAAAGGGAAGG + Intergenic
1010916046 6:81620450-81620472 CTCTTAGAGGTGTGGATGGGTGG - Intronic
1012151958 6:95764913-95764935 GATTTAGAAGAGTGAATAGATGG + Intergenic
1012287650 6:97412495-97412517 GTTTTAGCAGTCTGAATAGAAGG - Intergenic
1015516179 6:134084839-134084861 CATTAAGAAGTGTGAATTGGAGG + Intergenic
1017270970 6:152504904-152504926 GTTTTAGAAGTGTGTGTATGAGG - Intronic
1017561054 6:155628205-155628227 ATTTTAGAAGTGAGGAAGGGAGG + Intergenic
1018916457 6:168135349-168135371 GTATTAGGAGTGGGAATGGATGG - Intergenic
1022134670 7:27436099-27436121 GGTTTACAAGTGTGTATGTGTGG - Intergenic
1023600055 7:41873821-41873843 TTCTTTGAAGTGTGAATTGGAGG - Intergenic
1024815784 7:53269475-53269497 ATTTTTAAATTGTGAATGGGAGG + Intergenic
1027784533 7:82564341-82564363 ATTCTGGAAGTGGGAATGGGAGG + Intergenic
1028127013 7:87125177-87125199 GTTTGAAAAATGTGTATGGGAGG - Intergenic
1030536208 7:110770491-110770513 GGTGAAGAAGTGTGACTGGGAGG - Intronic
1030641540 7:112011795-112011817 TTTTTAGAAGTATGGATAGGTGG - Intronic
1031533491 7:122905628-122905650 GTTTTCGATGTGTGGAGGGGAGG - Intergenic
1032032303 7:128494564-128494586 GTTTTAGAACTGTGAACTGTGGG + Intronic
1033913272 7:146290454-146290476 GCTTCAGAATTGTGAATTGGCGG - Intronic
1033923294 7:146423453-146423475 GTTTTAGAAGTGTGTATGCAAGG + Intronic
1036726624 8:11226539-11226561 GTTTTAATAGTGTTAATGGGGGG - Intergenic
1038301114 8:26349774-26349796 GTTTTAGAACTTTGAATAGATGG + Intronic
1039231066 8:35448763-35448785 GATTTGGAAGGGTGAAAGGGTGG - Intronic
1039406096 8:37313948-37313970 GTTTACAAAGTGTGCATGGGAGG + Intergenic
1040460030 8:47638502-47638524 GCTTTAGAAGTATGAATGCTCGG + Intronic
1041366508 8:57111633-57111655 GCTCTAGATGTGTGAATGGAGGG + Intergenic
1041626482 8:60034630-60034652 GTTTGGTAAGTGTGAATGTGAGG - Intergenic
1042655641 8:71092315-71092337 GTTTTAGAAGAGTCCATGTGGGG - Intergenic
1043980251 8:86629941-86629963 GTCTTAGGAGTGTGAAAGTGAGG - Intronic
1045735555 8:105292566-105292588 AATTTCGAAGTGTGAAAGGGAGG + Intronic
1050002832 9:1096836-1096858 ATTTTACAGGTGTGAATGGCAGG + Intergenic
1053037921 9:34841297-34841319 TTTTTAGAAGTGTGAATTTCTGG - Intergenic
1056092855 9:83221231-83221253 GATTTGGAAGTTTGAATTGGAGG - Intergenic
1058854935 9:109052218-109052240 ATTTTAGAAATGGTAATGGGAGG - Intronic
1060843972 9:126819899-126819921 GTTTTAGTGGTCTGAATGGAAGG + Intronic
1190526669 X:51335006-51335028 GTTTTTGAAGAGAGTATGGGTGG + Intronic
1192727130 X:73765337-73765359 GTGTCAGGAGTGTGACTGGGAGG - Intergenic
1194694892 X:97034758-97034780 TTTTTAAAAGTGTGTATGTGTGG + Intronic
1197371294 X:125628746-125628768 GGGTTAGGAGTGTGACTGGGAGG + Intergenic
1197828561 X:130616324-130616346 GTTTTAGACTTGTGAATGTATGG + Intergenic
1197852987 X:130883724-130883746 GTTTTAGAGGAGTGAAGGGCAGG - Intronic
1199495360 X:148446710-148446732 GTTTCAGAGGTGTGCATAGGAGG + Intergenic
1199762346 X:150914762-150914784 ATTTTAAAAGAGTGAATGGCCGG + Intergenic
1199965216 X:152814375-152814397 GTTTAAGAAGTGGGAAGAGGAGG - Intergenic
1201414569 Y:13735448-13735470 GTTTTAGAAGTGTGGATTTGGGG - Intergenic
1201414636 Y:13735914-13735936 CTTTTAGAAGTGTGGATTTGGGG + Intergenic
1201957168 Y:19638216-19638238 GGGTTAGGAGTGTGACTGGGAGG - Intergenic