ID: 1140690289

View in Genome Browser
Species Human (GRCh38)
Location 16:77477348-77477370
Sequence ACATCATAAAAGTGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140690289_1140690296 20 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690296 16:77477391-77477413 GCCATGTCCTCACATGGTGAAGG No data
1140690289_1140690301 27 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG No data
1140690289_1140690295 14 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690295 16:77477385-77477407 AGGAAGGCCATGTCCTCACATGG No data
1140690289_1140690293 -2 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690293 16:77477369-77477391 GTATCCTCTGGAGGAAAGGAAGG No data
1140690289_1140690299 26 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690299 16:77477397-77477419 TCCTCACATGGTGAAGGTGGAGG No data
1140690289_1140690292 -6 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690292 16:77477365-77477387 TGATGTATCCTCTGGAGGAAAGG No data
1140690289_1140690302 28 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690302 16:77477399-77477421 CTCACATGGTGAAGGTGGAGGGG No data
1140690289_1140690298 23 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690298 16:77477394-77477416 ATGTCCTCACATGGTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140690289 Original CRISPR ACATCATAAAAGTGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr