ID: 1140690294

View in Genome Browser
Species Human (GRCh38)
Location 16:77477373-77477395
Sequence ATGGCCTTCCTTTCCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140690294_1140690302 3 Left 1140690294 16:77477373-77477395 CCTCTGGAGGAAAGGAAGGCCAT No data
Right 1140690302 16:77477399-77477421 CTCACATGGTGAAGGTGGAGGGG No data
1140690294_1140690301 2 Left 1140690294 16:77477373-77477395 CCTCTGGAGGAAAGGAAGGCCAT No data
Right 1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG No data
1140690294_1140690299 1 Left 1140690294 16:77477373-77477395 CCTCTGGAGGAAAGGAAGGCCAT No data
Right 1140690299 16:77477397-77477419 TCCTCACATGGTGAAGGTGGAGG No data
1140690294_1140690296 -5 Left 1140690294 16:77477373-77477395 CCTCTGGAGGAAAGGAAGGCCAT No data
Right 1140690296 16:77477391-77477413 GCCATGTCCTCACATGGTGAAGG No data
1140690294_1140690298 -2 Left 1140690294 16:77477373-77477395 CCTCTGGAGGAAAGGAAGGCCAT No data
Right 1140690298 16:77477394-77477416 ATGTCCTCACATGGTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140690294 Original CRISPR ATGGCCTTCCTTTCCTCCAG AGG (reversed) Intergenic
No off target data available for this crispr