ID: 1140690301

View in Genome Browser
Species Human (GRCh38)
Location 16:77477398-77477420
Sequence CCTCACATGGTGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140690294_1140690301 2 Left 1140690294 16:77477373-77477395 CCTCTGGAGGAAAGGAAGGCCAT No data
Right 1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG No data
1140690289_1140690301 27 Left 1140690289 16:77477348-77477370 CCAAGATGGCACTTTTATGATGT No data
Right 1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140690301 Original CRISPR CCTCACATGGTGAAGGTGGA GGG Intergenic
No off target data available for this crispr