ID: 1140696048

View in Genome Browser
Species Human (GRCh38)
Location 16:77535407-77535429
Sequence TACATGAGGCTGCTACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140696042_1140696048 27 Left 1140696042 16:77535357-77535379 CCCAAGAAAGGGGAGACAATGTG No data
Right 1140696048 16:77535407-77535429 TACATGAGGCTGCTACAAACAGG No data
1140696043_1140696048 26 Left 1140696043 16:77535358-77535380 CCAAGAAAGGGGAGACAATGTGG No data
Right 1140696048 16:77535407-77535429 TACATGAGGCTGCTACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140696048 Original CRISPR TACATGAGGCTGCTACAAAC AGG Intergenic
No off target data available for this crispr