ID: 1140696874

View in Genome Browser
Species Human (GRCh38)
Location 16:77543421-77543443
Sequence CCCTGTCTGTAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140696870_1140696874 7 Left 1140696870 16:77543391-77543413 CCAGGTAGAAGGAGCGGCATGTA No data
Right 1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140696874 Original CRISPR CCCTGTCTGTAGAAGGAGGA AGG Intergenic
No off target data available for this crispr