ID: 1140699544

View in Genome Browser
Species Human (GRCh38)
Location 16:77568580-77568602
Sequence GTATATACAAATGTGAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140699544_1140699546 13 Left 1140699544 16:77568580-77568602 CCAAGGTTCACATTTGTATATAC No data
Right 1140699546 16:77568616-77568638 TTCTGATACCGTGTCTACTGTGG No data
1140699544_1140699547 17 Left 1140699544 16:77568580-77568602 CCAAGGTTCACATTTGTATATAC No data
Right 1140699547 16:77568620-77568642 GATACCGTGTCTACTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140699544 Original CRISPR GTATATACAAATGTGAACCT TGG (reversed) Intergenic
No off target data available for this crispr