ID: 1140700189

View in Genome Browser
Species Human (GRCh38)
Location 16:77574536-77574558
Sequence ACCAAAAATGAATCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700186_1140700189 -9 Left 1140700186 16:77574522-77574544 CCCCAGTTTTAAGAACCAAAAAT No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700180_1140700189 23 Left 1140700180 16:77574490-77574512 CCTGCCTCCACCCACTCAATGCC No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700187_1140700189 -10 Left 1140700187 16:77574523-77574545 CCCAGTTTTAAGAACCAAAAATG No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700183_1140700189 13 Left 1140700183 16:77574500-77574522 CCCACTCAATGCCAGTTACACTC No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700181_1140700189 19 Left 1140700181 16:77574494-77574516 CCTCCACCCACTCAATGCCAGTT No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700184_1140700189 12 Left 1140700184 16:77574501-77574523 CCACTCAATGCCAGTTACACTCC No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700185_1140700189 2 Left 1140700185 16:77574511-77574533 CCAGTTACACTCCCCAGTTTTAA No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700182_1140700189 16 Left 1140700182 16:77574497-77574519 CCACCCACTCAATGCCAGTTACA No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700178_1140700189 27 Left 1140700178 16:77574486-77574508 CCTCCCTGCCTCCACCCACTCAA No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data
1140700179_1140700189 24 Left 1140700179 16:77574489-77574511 CCCTGCCTCCACCCACTCAATGC No data
Right 1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700189 Original CRISPR ACCAAAAATGAATCCAGACA TGG Intergenic
No off target data available for this crispr