ID: 1140700263

View in Genome Browser
Species Human (GRCh38)
Location 16:77575056-77575078
Sequence CCTGGGCCGTCTGAGCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700263_1140700268 -9 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700268 16:77575070-77575092 CGGCCCAGGGAAATCCTGGAGGG No data
1140700263_1140700267 -10 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700267 16:77575069-77575091 ACGGCCCAGGGAAATCCTGGAGG No data
1140700263_1140700277 16 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
1140700263_1140700273 4 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700273 16:77575083-77575105 TCCTGGAGGGGACCTGCCAAGGG No data
1140700263_1140700275 10 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700275 16:77575089-77575111 AGGGGACCTGCCAAGGGCTGTGG No data
1140700263_1140700269 -8 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700269 16:77575071-77575093 GGCCCAGGGAAATCCTGGAGGGG No data
1140700263_1140700272 3 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700272 16:77575082-77575104 ATCCTGGAGGGGACCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700263 Original CRISPR CCTGGGCCGTCTGAGCACCG TGG (reversed) Intergenic