ID: 1140700270

View in Genome Browser
Species Human (GRCh38)
Location 16:77575073-77575095
Sequence GTCCCCTCCAGGATTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700270_1140700281 25 Left 1140700270 16:77575073-77575095 CCCAGGGAAATCCTGGAGGGGAC No data
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data
1140700270_1140700280 22 Left 1140700270 16:77575073-77575095 CCCAGGGAAATCCTGGAGGGGAC No data
Right 1140700280 16:77575118-77575140 AAGCAGATCTCCCTCCTTATCGG No data
1140700270_1140700277 -1 Left 1140700270 16:77575073-77575095 CCCAGGGAAATCCTGGAGGGGAC No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
1140700270_1140700275 -7 Left 1140700270 16:77575073-77575095 CCCAGGGAAATCCTGGAGGGGAC No data
Right 1140700275 16:77575089-77575111 AGGGGACCTGCCAAGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700270 Original CRISPR GTCCCCTCCAGGATTTCCCT GGG (reversed) Intergenic