ID: 1140700271

View in Genome Browser
Species Human (GRCh38)
Location 16:77575074-77575096
Sequence GGTCCCCTCCAGGATTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700271_1140700282 30 Left 1140700271 16:77575074-77575096 CCAGGGAAATCCTGGAGGGGACC No data
Right 1140700282 16:77575127-77575149 TCCCTCCTTATCGGCGGAGTAGG No data
1140700271_1140700281 24 Left 1140700271 16:77575074-77575096 CCAGGGAAATCCTGGAGGGGACC No data
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data
1140700271_1140700275 -8 Left 1140700271 16:77575074-77575096 CCAGGGAAATCCTGGAGGGGACC No data
Right 1140700275 16:77575089-77575111 AGGGGACCTGCCAAGGGCTGTGG No data
1140700271_1140700280 21 Left 1140700271 16:77575074-77575096 CCAGGGAAATCCTGGAGGGGACC No data
Right 1140700280 16:77575118-77575140 AAGCAGATCTCCCTCCTTATCGG No data
1140700271_1140700277 -2 Left 1140700271 16:77575074-77575096 CCAGGGAAATCCTGGAGGGGACC No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700271 Original CRISPR GGTCCCCTCCAGGATTTCCC TGG (reversed) Intergenic