ID: 1140700274

View in Genome Browser
Species Human (GRCh38)
Location 16:77575084-77575106
Sequence GCCCTTGGCAGGTCCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700274_1140700281 14 Left 1140700274 16:77575084-77575106 CCTGGAGGGGACCTGCCAAGGGC No data
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data
1140700274_1140700282 20 Left 1140700274 16:77575084-77575106 CCTGGAGGGGACCTGCCAAGGGC No data
Right 1140700282 16:77575127-77575149 TCCCTCCTTATCGGCGGAGTAGG No data
1140700274_1140700280 11 Left 1140700274 16:77575084-77575106 CCTGGAGGGGACCTGCCAAGGGC No data
Right 1140700280 16:77575118-77575140 AAGCAGATCTCCCTCCTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700274 Original CRISPR GCCCTTGGCAGGTCCCCTCC AGG (reversed) Intergenic