ID: 1140700277

View in Genome Browser
Species Human (GRCh38)
Location 16:77575095-77575117
Sequence CCTGCCAAGGGCTGTGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700263_1140700277 16 Left 1140700263 16:77575056-77575078 CCACGGTGCTCAGACGGCCCAGG No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
1140700262_1140700277 17 Left 1140700262 16:77575055-77575077 CCCACGGTGCTCAGACGGCCCAG No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
1140700270_1140700277 -1 Left 1140700270 16:77575073-77575095 CCCAGGGAAATCCTGGAGGGGAC No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
1140700271_1140700277 -2 Left 1140700271 16:77575074-77575096 CCAGGGAAATCCTGGAGGGGACC No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
1140700259_1140700277 28 Left 1140700259 16:77575044-77575066 CCTCTCATCTCCCCACGGTGCTC No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
1140700261_1140700277 18 Left 1140700261 16:77575054-77575076 CCCCACGGTGCTCAGACGGCCCA No data
Right 1140700277 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700277 Original CRISPR CCTGCCAAGGGCTGTGGCCG AGG Intergenic