ID: 1140700281

View in Genome Browser
Species Human (GRCh38)
Location 16:77575121-77575143
Sequence CAGATCTCCCTCCTTATCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700278_1140700281 -1 Left 1140700278 16:77575099-77575121 CCAAGGGCTGTGGCCGAGGAAGC No data
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data
1140700271_1140700281 24 Left 1140700271 16:77575074-77575096 CCAGGGAAATCCTGGAGGGGACC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data
1140700270_1140700281 25 Left 1140700270 16:77575073-77575095 CCCAGGGAAATCCTGGAGGGGAC No data
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data
1140700276_1140700281 3 Left 1140700276 16:77575095-77575117 CCTGCCAAGGGCTGTGGCCGAGG No data
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data
1140700274_1140700281 14 Left 1140700274 16:77575084-77575106 CCTGGAGGGGACCTGCCAAGGGC No data
Right 1140700281 16:77575121-77575143 CAGATCTCCCTCCTTATCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700281 Original CRISPR CAGATCTCCCTCCTTATCGG CGG Intergenic