ID: 1140700946

View in Genome Browser
Species Human (GRCh38)
Location 16:77581077-77581099
Sequence CTGTCCAAGGAGAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140700937_1140700946 30 Left 1140700937 16:77581024-77581046 CCTCTTGGGATATGCTAACAGTG No data
Right 1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140700946 Original CRISPR CTGTCCAAGGAGAAGATGGC TGG Intergenic
No off target data available for this crispr