ID: 1140704496

View in Genome Browser
Species Human (GRCh38)
Location 16:77614015-77614037
Sequence TTATCCACTGACTGGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140704496_1140704498 0 Left 1140704496 16:77614015-77614037 CCAGTCAGCCAGTCAGTGGATAA No data
Right 1140704498 16:77614038-77614060 ATGAGTAACTAACAAACTAGTGG No data
1140704496_1140704499 10 Left 1140704496 16:77614015-77614037 CCAGTCAGCCAGTCAGTGGATAA No data
Right 1140704499 16:77614048-77614070 AACAAACTAGTGGACTGATGTGG No data
1140704496_1140704500 15 Left 1140704496 16:77614015-77614037 CCAGTCAGCCAGTCAGTGGATAA No data
Right 1140704500 16:77614053-77614075 ACTAGTGGACTGATGTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140704496 Original CRISPR TTATCCACTGACTGGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr