ID: 1140705851

View in Genome Browser
Species Human (GRCh38)
Location 16:77628464-77628486
Sequence TGGTAGGTGAATGAATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140705846_1140705851 9 Left 1140705846 16:77628432-77628454 CCTTCTGCCACAGTGACCTTCAT No data
Right 1140705851 16:77628464-77628486 TGGTAGGTGAATGAATGCTCTGG No data
1140705849_1140705851 -7 Left 1140705849 16:77628448-77628470 CCTTCATCATTCTTCATGGTAGG No data
Right 1140705851 16:77628464-77628486 TGGTAGGTGAATGAATGCTCTGG No data
1140705847_1140705851 2 Left 1140705847 16:77628439-77628461 CCACAGTGACCTTCATCATTCTT No data
Right 1140705851 16:77628464-77628486 TGGTAGGTGAATGAATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140705851 Original CRISPR TGGTAGGTGAATGAATGCTC TGG Intergenic
No off target data available for this crispr