ID: 1140708398

View in Genome Browser
Species Human (GRCh38)
Location 16:77653075-77653097
Sequence GGAGAGAAGGCGGACTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140708398_1140708405 20 Left 1140708398 16:77653075-77653097 CCACTGAAGTCCGCCTTCTCTCC No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data
1140708398_1140708402 4 Left 1140708398 16:77653075-77653097 CCACTGAAGTCCGCCTTCTCTCC No data
Right 1140708402 16:77653102-77653124 GACCAGCATTTCTCCAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140708398 Original CRISPR GGAGAGAAGGCGGACTTCAG TGG (reversed) Intergenic
No off target data available for this crispr